설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TTTGAGAAGAGGCAGGTGGTGGAAGGTTCAAGTTCAGTTGGTCCCTTGCCATCAGGAAGTGTGCTTTCATCAGACAACCAGTTTAATGAAGAATCTTTAGAACACGATGTTCTTGATGATAATACAGAGCAGACAGATGACAAAATACCAGCTACAGAACAGACAAACCAAGTGATTGAAAAAGCATCTGACTCAGAGGAACCAGAGGAGAAACAAGAGACTGAGAATGAGGAAGCCTCAGTGATTGAAACCAACTCCACAGTTCCTGGAGCTGATTCTATTCCTGATCCTGAACTAAGTGGAGAATCTTTGACGGCAGAGTAGTAAATGCTTCCACGTGCCTTCAACTGGATATTTATAGTCTTACTGATGTCAGTTATTGCTTTTTCGGTGGCACTTAC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... LNPK(80856) , KIAA1715(80856)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Scientific reports, 7(1), 5883-5883 (2017-07-21)
Endometriosis, a major reproductive pathology affecting 8-10% of women is characterized by chronic inflammation and immune dysfunction. Human antigen R (HuR) and Tristetraprolin (TTP) are RNA binding proteins that competitively bind to cytokines involved in inflammation including: tumor necrosis factor
Molecular therapy. Nucleic acids, 5(9), e363-e363 (2016-09-14)
Sclerostin is a protein secreted by osteocytes that is encoded by the SOST gene; it decreases bone formation by reducing osteoblast differentiation through inhibition of the Wnt signaling pathway. Silencing the SOST gene using RNA interference (RNAi) could therefore be
Biochemical and biophysical research communications, 449(4), 460-465 (2014-05-24)
An Fab' antibody against heparin-binding epidermal growth factor-like growth factor (HB-EGF) was applied to achieve advanced tumor-targeted delivery of siRNA. Lipid nanoparticles (LNP) encapsulating siRNA (LNP-siRNA) were prepared, pegylated, and surface modified with Fab' fragments of anti-HB-EGF antibody (αHB-EGF LNP-siRNA).
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.