설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CCCAGGGCAAATAGTCAAGAAGCCAGTGATGGTCATTGGGACCTGCACCTGTCACACCAACTGTCCTAAGAACAATGAGGCCTTCCTCCAGGAGCTGGAGCTGAAGACTACCAGAGGGAAAATGTAACCTGTCACTCAAGAAGCACACCTACAGAGCACCTGTAGCTGCTGCGCCACCCACCATCAAAGGAATATAAGAAAAGTAATGAAGAATCACGATTTCATCCTTGAATCCTATGTATTTTCCTAATGTGATCATATGAGGACCTTTATATCTGTCTTTTATTTAACAAAAAATGTAATTAACTGTAAACTTGGAATCAAGGTAAGCTCAGGATATGGCTTAGGAATGACTTACTTTCCTGTGGTTTTATTACAAATGCAAATTTCTATAAATTTAAGAAAACAAGTATATAATTTACTTTGTAGACTGTTTCACATTGCACTCATCA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Oncotarget, 8(43), 74506-74518 (2017-11-02)
Epithelial-mesenchymal transition (EMT) has received considerable attention as a conceptual paradigm for explaining metastatic behavior during cancer progression. NOV/CCN3 is a matrix-associated protein involved in many cellular functions. Previous studies have shown that CCN3 expression is upregulated in prostate cancer
hsa-mir-30c promotes the invasive phenotype of metastatic breast cancer cells by targeting NOV/CCN3.
Cancer cell international, 14, 73-73 (2014-08-15)
For treatment and prevention of metastatic disease, one of the premier challenges is the identification of pathways and proteins to target for clinical intervention. Micro RNAs (miRNAs) are short, non-coding RNAs, which regulate cellular activities by either mRNA degradation or
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.