설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GCCGCTGTGTAGGAAAGAAGCTAAAGCACTTCCAGAGCCTGTCCGGAGCTCAGAGGTTCGGAAGACTTATCGACCATGGAGCGCGCGTCCTGCTTGTTGCTGCTGCTGCTGCCGCTGGTGCACGTCTCTGCGACCACGCCAGAACCTTGTGAGCTGGACGATGAAGATTTCCGCTGCGTCTGCAACTTCTCCGAACCTCAGCCCGACTGGTCCGAAGCCTTCCAGTGTGTGTCTGCAGTAGAGGTGGAGATCCATGCCGGCGGTCTCAACCTAGAGCCGTTTCTAAAGCGCGTCGATGCGGACGCCGACCCGCGGCAGTATGCTGACACGGTCAAGGCTCTCCGCGTGCGGCGGCTCACAGTGGGAGCCGCACAGGTTCCTGCTCAGCTACTGGTAGGCGCCCTGCGTGTGCTAGCGTACTCCCGCCTCAAGGAACTGACGCTCGAGGACCTA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Mai Fujikura et al.
Journal of Alzheimer's disease : JAD, 68(1), 323-337 (2019-02-19)
We previously demonstrated that microglia play an essential role in clearance of amyloid-β (Aβ) in Alzheimer's disease (AD)-like pathology. Our prior work also showed that several receptors expressed on microglia participated in Aβ phagocytosis. However, clathrin-mediated endocytosis (CME), which is
Prelamin A accumulation in endothelial cells induces premature senescence and functional impairment.
Nathalie Bonello-Palot et al.
Atherosclerosis, 237(1), 45-52 (2014-09-10)
Defects in lamin A maturation result in premature aging syndromes and severe atherosclerosis as observed in the Hutchinson-Gilford Progeria Syndrome. In age-related atherosclerosis, several features of cellular senescence have been characterized in endothelial cells including telomere shortening and increased oxidative
Elena M V de Cavanagh et al.
American journal of physiology. Heart and circulatory physiology, 307(2), H207-H215 (2014-05-27)
Early endothelial progenitor cells (early EPC) and late EPC are involved in endothelial repair and can rescue damaged endothelial cells by transferring organelles through tunneling nanotubes (TNT). In rodents, EPC mobilization from the bone marrow depends on sympathetic nervous system
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.