설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CCGAGATGGCAGATGAGATTGCCAAGGCTCAGGTCGCTCGGCCTGGTGGCGACACGATCTTTGGGAAGATCATCCGCAAGGAAATACCAGCCAAAATCATTTTTGAGGATGACCGGTGCCTTGCTTTCCATGACATTTCCCCTCAAGCACCAACACATTTTCTGGTGATACCCAAGAAACATATATCCCAGATTTCTGTGGCAGAAGATGATGATGAAAGTCTTCTTGGACACTTAATGATTGTTGGCAAGAAATGTGCTGCTGATCTGGGCCTGAATAAGGGTTATCGAATGGTGGTGAATGAAGGTTCAGATGGTGGACAGTCTGTCTATCACGTTCATCTCCATGTTCTTGGAGGTCGGCAAATGCATTGGCCTCCTGGTTAAGCACGTTTTGGGGAT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... HINT1(3094) , HINT1(3094)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Zhitian Shi et al.
Digestive diseases and sciences, 61(3), 785-794 (2015-11-02)
There is increasing evidence that histidine triad nucleotide-binding protein 1 (HINT1) is a novel tumor suppressor. In the present study, we investigated the mechanism by which HINT1 promotes the stability of inhibitor of NF-κB α (IκBα) in the cytoplasm of
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.