콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU050781

Sigma-Aldrich

MISSION® esiRNA

targeting human LIN28B

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GCCCCTTGGATATTCCAGTCGATGTATTTGTACACCAAAGCAAACTATTCATGGAAGGATTTAGAAGCCTAAAAGAAGGAGAACCAGTGGAATTCACATTTAAAAAATCTTCCAAAGGCCTTGAGTCAATACGGGTAACAGGACCTGGTGGGAGCCCCTGTTTAGGAAGTGAAAGAAGACCCAAAGGGAAGACACTACAGAAAAGAAAACCAAAGGGAGATAGATGCTACAACTGTGGTGGCCTTGATCATCATGCTAAGGAATGTAGTCTACCTCCTCAGCCAAAGAAGTGCCATTACTGTCAGAGCATCATGCACATGGTGGCAAACTGCCCACATAAAAATGTTGCACAGCCACCCGCGAGTTCTCAGGGAAGACAGGAAGCAGAATCCCAGCCATGCACTTCAACTCTCCCTCGAGAAGTGGGAGGCGGGCATGGCTGTACATCACCAC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jianbiao Zhou et al.
Journal of hematology & oncology, 10(1), 138-138 (2017-07-12)
Current conventional chemotherapy for acute myeloid leukemia (AML) can achieve remission in over 70% of patients, but a majority of them will relapse within 5 years despite continued treatment. The relapse is postulated to be due to leukemia stem cells (LSCs)
Jing Wu et al.
Acta biochimica et biophysica Sinica, 51(5), 455-462 (2019-04-09)
Choriocarcinoma is a rare and malignant trophoblastic tumor. However, the molecular mechanisms by which choriocarcinoma is regulated remain unknown. In the present study, we first elucidated that LIN28B was highly expressed in human choriocarcinoma tissues and choriocarcinoma cell lines. Our
Chong Chen et al.
Cancer research, 75(8), 1725-1735 (2015-03-07)
Considerable evidence suggests that proinflammatory pathways drive self-renewal of cancer stem-like cells (CSC), but the underlying mechanisms remain mainly undefined. Here we report that the let7 repressor LIN28B and its regulator IKBKB (IKKβ) sustain cancer cell stemness by interacting with
B-X Yan et al.
Oncogene, 33(45), 5288-5294 (2013-11-05)
Tumor drug resistance remains a major challenge in the treatment of cancer. Here, we show that Prostatic secretory protein 94 (PSP94) levels are reduced in ovarian cancer patients with high levels of excision repair cross-complementing 1 (ERCC1), a marker for

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.