콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU050311

Sigma-Aldrich

MISSION® esiRNA

targeting human PTGS2

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TGCGGGAACACAACAGAGTATGCGATGTGCTTAAACAGGAGCATCCTGAATGGGGTGATGAGCAGTTGTTCCAGACAAGCAGGCTAATACTGATAGGAGAGACTATTAAGATTGTGATTGAAGATTATGTGCAACACTTGAGTGGCTATCACTTCAAACTGAAATTTGACCCAGAACTACTTTTCAACAAACAATTCCAGTACCAAAATCGTATTGCTGCTGAATTTAACACCCTCTATCACTGGCATCCCCTTCTGCCTGACACCTTTCAAATTCATGACCAGAAATACAACTATCAACAGTTTATCTACAACAACTCTATATTGCTGGAACATGGAATTACCCAGTTTGTTGAATCATTCACCAGGCAAATTGCTGGCAGGGTTGCTGGTGGTAGGAATG

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Mia Madel Alfajaro et al.
PloS one, 13(7), e0200726-e0200726 (2018-07-19)
Cyclooxygenases (COXs)/prostaglandin E2 (PGE2) signaling pathways are known to modulate a variety of homeostatic processes and are involved in various pathophysiological conditions. COXs/PGE2 signaling pathways have also been demonstrated to have proviral or antiviral effects, which appeared different even in
Denise Philipp et al.
Stem cell research & therapy, 9(1), 286-286 (2018-10-26)
During the last decade, mesenchymal stem cells (MSCs) have gained much attention in the field of regenerative medicine due to their capacity to differentiate into different cell types and to promote immunosuppressive effects. However, the underlying mechanism of MSC-mediated immunoregulation
Bing-Wei Dong et al.
Biochemical and biophysical research communications, 503(4), 2293-2300 (2018-07-03)
Cisplatin (CDDP)-based systematic chemotherapy remains the mainstay of treatment for muscle-invasive bladder cancer (MIBC). However, acquired resistance to CDDP, a multifactorial process governed by an array of signals acting at different levels, is the major problem in BC treatment. Here
Lei Zhang et al.
Reproduction, fertility, and development (2018-07-10)
Circular RNAs (circRNAs) have been found to play important functional roles in epigenetic regulation under certain physiological and pathological conditions. However, knowledge of circRNAs during the development of receptive endometrium (RE) from pre-RE is limited. In the RE of dairy
Bing-Bing Lei et al.
Journal of molecular neuroscience : MN, 67(2), 173-180 (2018-11-25)
The cold-inducible protein RBM3 mediates hypothermic neuroprotection against nitric oxide (NO)-induced cell death. Meanwhile, it is well-known that cyclooxygenase-2 (COX-2) is upregulated by RBM3 in several types of cells; however, it is still unclear whether COX-2 contributes to the neuroprotective

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.