콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU050181

Sigma-Aldrich

MISSION® esiRNA

targeting human LRG1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CCATCTCCTGTCAACCACCTGCCGAAATCCCCGGCTACCTGCCAGCCGACACCGTGCACCTGGCCGTGGAATTCTTCAACCTGACCCACCTGCCAGCCAACCTCCTCCAGGGCGCCTCTAAGCTCCAAGAATTGCACCTCTCCAGCAATGGGCTGGAAAGCCTCTCGCCCGAATTCCTGCGGCCAGTGCCGCAGCTGAGGGTGCTGGATCTAACCCGAAACGCCCTGACCGGGCTGCCCCCGGGCCTCTTCCAGGCCTCAGCCACCCTGGACACCCTGGTATTGAAAGAAAACCAGCTGGAGGTCCTGGAGGTCTCGTGGCTACACGGCCTGAAAGCTCTGGGGCATCTGGACCTGTCTGGGAACCGCCTCCGGAAACTGCCCCCCGGGCTGCTGGCCAACTTCACCCTCCTGCGCACCCTTGACCTTGGGGAGAACCAGTTGGAGACCTTGC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yiyun Wang et al.
Cell death & disease, 8(3), e2715-e2715 (2017-03-31)
The incomplete understanding of aberrant neovascularization, which contributes to osteoarthritis suggests that additional modulators have yet to be identified. Our objective was to identify the role of Leucine-rich-alpha-2-glycoprotein1 (LRG1), a new regulator of pathogenic angiogenesis, in osteoarthritis progression and to
Lan Luan et al.
Experimental and therapeutic medicine, 21(4), 367-367 (2021-03-19)
Retinoblastoma (RB) is the most common primary intraocular cancer type that occurs during retinal development in childhood. Previous studies have reported that long non-coding RNAs (lncRNAs) are involved in the development of RB. Therefore, the aim of the present study
Qian Zhang et al.
OncoTargets and therapy, 11, 2745-2752 (2018-05-23)
Leucine-rich α-2-glycoprotein-1 (LRG1) is differentially expressed in many kinds of diseases including cancer, however, it has not been thoroughly studied yet. The objective of this study was to detect the expression and potential mechanism of LRG1 in colorectal cancer (CRC).
Masaaki Yamamoto et al.
Cancer science, 108(10), 2052-2060 (2017-07-27)
Gastric cancer is one of the most common malignant tumors. Although improvement in chemotherapy has been achieved, the clinical prognosis of advanced gastric cancer remains poor. Therefore, it is increasingly important to predict the prognosis and determine whether patients should
Gu Gong et al.
Journal of molecular neuroscience : MN, 54(1), 20-26 (2014-02-15)
Lipopolysaccharide (LPS) preconditioning is a powerful neuroprotective phenomenon by which an injurious stimulus renders the brain resistant to a subsequent damaging ischemic insult. The LPS response gene (Lrg) is a recently identified gene in human dental pulp cells treated with

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.