설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TGGACTAACTCTGCCCCAGTTTATCTTGAAGGAAGAGAAGGACTTGAGATACTGCACCAAGCACTACAACACAGGTAAATTCACCTGCATTGAGGCCCGGTTCCACCTGGAGCGGCAGATGGGTTACTACCTGATTCAGATGTATATTCCCAGCCTGCTCATTGTCATCCTCTCATGGATCTCCTTCTGGATCAACATGGATGCTGCACCTGCTCGTGTGGGCCTAGGCATCACCACTGTGCTCACCATGACCACCCAGAGCTCCGGCTCTCGAGCATCTCTGCCCAAGGTGTCCTATGTGAAAGCCATTGACATTTGGATGGCAGTTTGCCTGCTCTTTGTGTTCTCAGCCCTATTAGAATATGCTGCCGTTAACTTTGTGTCTCGGCAACATAAGGAGCT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... GLRA1(2741) , GLRA1(2741)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Inhalable siRNA-loaded nano-embedded microparticles engineered using microfluidics and spray drying.
Monica Agnoletti et al.
European journal of pharmaceutics and biopharmaceutics : official journal of Arbeitsgemeinschaft fur Pharmazeutische Verfahrenstechnik e.V, 120, 9-21 (2017-08-07)
Medicines based on small interfering RNA (siRNA) are promising for the treatment of a number of lung diseases. However, efficient delivery systems and design of stable dosage forms are required for inhalation therapy, as well as cost-effective methods for manufacturing
Jiaguo Wu et al.
Biochemical and biophysical research communications, 452(3), 554-559 (2014-08-31)
NF-E2 P45-related factor 2 (Nrf2) is a key transcription factor that controls genes encoding cytoprotective and detoxifying enzymes through antioxidant response elements (AREs) in their regulatory regions. We reported recently that retinoid X receptor alpha (RXRα) inhibits Nrf2 function by
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.