설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CAAGGATGGCATAGTGGTGATAATTGACATCAGTAAGAAAGGAGAAGTTATTCATAGGCTTCGAGGCCATGATGATGAAATCCACTCCATAGCCTGGTGTCCCCTGCCTGGTGAAGATTGTTTATCTATAAACCAAGAGGAAACTTCAGAAGAAGCTGAAATTACCAACGGGAATGCTGTAGCACAAGCTCCAGTAACAAAAGGTTGCTACTTAGCCACTGGAAGCAAAGATCAAACCATTCGAATCTGGAGCTGTTCTAGAGGCCGAGGGGTGATGATTTTGAAATTGCCCTTTCTGAAGAGAAGAGGAGGGGGTATAGACCCAACTGTTAAAGAGCGCCTTTGGTTGACACTCCATTGGCCCAGCAATCAACCAACACAGCTGGTATCTAGCTGTTTTGGAGGTGAACTGTTGCAATGGGATCTCACTCAATCTTGGAGACGGAAATACACCC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... GEMIN5(25929) , GEMIN5(25929)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Javier Fernandez-Chamorro et al.
Nucleic acids research, 42(9), 5742-5754 (2014-03-07)
Ribonucleic acid (RNA)-binding proteins are key players of gene expression control. We have shown that Gemin5 interacts with internal ribosome entry site (IRES) elements and modulates initiation of translation. However, little is known about the RNA-binding sites of this protein.
Eileen Workman et al.
The Journal of biological chemistry, 290(25), 15662-15669 (2015-04-26)
Reduced expression of SMN causes spinal muscular atrophy, a severe neurodegenerative disease. Despite the importance of maintaining SMN levels, relatively little is known about the mechanisms by which SMN levels are regulated. We show here that Gemin5, the snRNA-binding protein
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.