콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU048931

Sigma-Aldrich

MISSION® esiRNA

targeting human PIM2

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TGGGCATCCTCCTCTATGACATGGTGTGTGGGGACATTCCCTTTGAGAGGGACCAGGAGATTCTGGAAGCTGAGCTCCACTTCCCAGCCCATGTCTCCCCAGACTGCTGTGCCCTAATCCGCCGGTGCCTGGCCCCCAAACCTTCTTCCCGACCCTCACTGGAAGAGATCCTGCTGGACCCCTGGATGCAAACACCAGCCGAGGATGTACCCCTCAACCCCTCCAAAGGAGGCCCTGCCCCTTTGGCCTGGTCCTTGCTACCCTAAGCCTGGCCTGGCCTGGCCTGGCCCCCAATGGTCAGAAGAGCCATCCCATGGCCATGTCACAGGGATAGATGGACATTTGTTGACTTGGTTTTACAGGTCATTACCAGTCATTAAAGTCCAGTATTACTAAGGTAAGGGATTGAGGATCAGGGGTTAGAAGACATAAACCAAGTCTGCCCAGTTCCCTTC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

J R Nair et al.
Leukemia, 31(8), 1715-1726 (2016-12-23)
The PIM kinase family (PIM1, 2 and 3) have a central role in integrating growth and survival signals, and are expressed in a wide range of solid and hematological malignancies. We now confirm that PIM2 is overexpressed in multiple myeloma
Tingting Yang et al.
Oncogene, 37(45), 5997-6009 (2018-07-10)
Hexokinase-II (HK2) is a key enzyme involved in glycolysis, which is required for breast cancer progression. However, the underlying post-translational mechanisms of HK2 activity are poorly understood. Here, we showed that Proviral Insertion in Murine Lymphomas 2 (PIM2) directly bound
Zhaoyun Liu et al.
Oncology letters, 17(6), 5395-5402 (2019-06-13)
PIM2 proto-oncogene, serine/threonine kinase (PIM2) is a serine/threonine protein kinase that is upregulated in different types of cancer and serves essential roles in the regulation of signal transduction cascades, which promote cell survival and cell proliferation. The present study demonstrated
Chune Ren et al.
Molecular oncology, 12(5), 690-704 (2018-03-24)
Tristetraprolin (TTP) is an AU-rich element-binding protein that regulates mRNA stability and plays important roles in cancer. The mechanisms by which TTP is regulated in breast cancer are poorly understood. Using multiple biochemical approaches, we found that proviral insertion in

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.