설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AGCCACATGTTCCTCCTGATCGAGGACCAAGGTGCCCAGGGCTATGAGCTGTTCTTCAAGACAAGAGAATTGAAGAAGAAGTGGATGGAGCAGTTTGAGATGGCCATCTCCAACATCTATCCGGAGAATGCCACCGCCAACGGGCATGACTTCCAGATGTTCTCCTTTGAGGAGACCACATCCTGCAAGGCCTGTCAGATGCTGCTTAGAGGTACCTTCTATCAGGGCTACCGCTGCCATCGGTGCCGGGCATCTGCACACAAGGAGTGTCTGGGGAGGGTCCCTCCATGTGGCCGACATGGGCAAGATTTCCCAGGAACTATGAAGAAGGACAAACTACATCGCAGGGCTCAGGACAAAAAGAGGAATGAGCTGGGTCTGCCCAAGATGGAGGTGTTTCAGGAATACTACGGGCTTCCTCCACCCCCTGGAGCCATTGGACCCTTTCTACGGCT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... VAV1(7409) , VAV1(7409)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Science signaling, 11(538) (2018-07-12)
The activation of T cells requires the guanine nucleotide exchange factor VAV1. Using mice in which a tag for affinity purification was attached to endogenous VAV1 molecules, we analyzed by quantitative mass spectrometry the signaling complex that assembles around activated
Journal of cellular biochemistry, 119(7), 5437-5448 (2018-01-26)
This study aims to explore the effect of miR-330 targeting VAV1 on amyloid β-protein (Aβ) production, oxidative stress (OS), and mitochondrial dysfunction in Alzheimer's disease (AD) mice through the MAPK signaling pathway. Putative targeted gene of miR-330 was performed by
Cell communication and signaling : CCS, 18(1), 3-3 (2020-01-08)
Ras are small cellular GTPases which regulate diverse cellular processes. It has three isoforms: H-Ras, K-Ras, and N-Ras. Owing to the N-terminus (1-165 residues) sequence homology these isoforms were thought to be functionally redundant. However, only K-Ras-deficient mice but not
Oncotarget, 5(12), 4320-4336 (2014-06-26)
Vav1 is one of the signalling proteins normally restricted to hematopoietic cells that results ectopically expressed in solid tumors, including breast cancer. By immunohistochemical analysis on TMAs containing invasive breast tumor from patients without lymph node involvement, we have found
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.