설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AGAGCGTTTCCAAGTCCTGAACCCCACCTGGAGTGCTGAGGCCCATGGCCTGGCTCCTGATGGTGACGTCTTTCTCTCAGAGGAGCAAGTCCGGAGCTTTCAGGTCCCAACCTGCGTTCAATGTGGAGGCCATCTGAAACCAGATGTCGTTTTCTTCGGGGACACAGTGAACCCTGACAAGGTTGATTTTGTGCACAAGCGTGTAAAAGAAGCCGACTCCCTCTTGGTGGTGGGATCATCCTTGCAGGTATACTCTGGTTACAGGTTTATCCTCACTGCCTGGGAGAAGAAGCTCCCGATTGCAATACTGAACATTGGGCCCACACGGTCGGATGACTTGGCGTGTCTGAAACTGAATTCTCGTTGTGGAGAGTTGCTGCCTTTGATAGACCCATGCTGACCA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... SIRT4(23409) , SIRT4(23409)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Hongjie Sun et al.
OncoTargets and therapy, 11, 3959-3968 (2018-07-20)
Previous study has proven that SIRT4 is downregulated in gastric cancer (GC), but the role of SIRT4 has not been clearly understood. The aim of our work was to explore in detail the function and mechanism of SIRT4 in GC.
Ratana Lim et al.
Biology of reproduction, 95(5), 95-95 (2016-11-05)
Preterm birth remains the major cause of neonatal mortality and morbidity, mediated largely by an inflammatory process. The sirtuin (SIRT) family of cellular regulators has been implicated as key inhibitors of inflammation. We have previously reported a role for SIRT1
Peixin Huang et al.
Oncotarget, 6(13), 10812-10824 (2015-05-01)
Aging is the predominant risk factor for cardiovascular diseases and contributes to a considerably more severe outcome in patients with acute myocardial infarction. Resveratrol, a polyphenol found in red wine, is a caloric restriction mimetic with potential anti-aging properties which
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.