설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GCCGCAGACCTTGTGATATTCCAGTTCCCCCTGCAGTGGTTTGGAGTCCCTGCCATTCTGAAAGGCTGGTTTGAGCGAGTGTTCATAGGAGAGTTTGCTTACACTTACGCTGCCATGTATGACAAAGGACCCTTCCGGAGTAAGAAGGCAGTGCTTTCCATCACCACTGGTGGCAGTGGCTCCATGTACTCTCTGCAAGGGATCCACGGGGACATGAATGTCATTCTCTGGCCAATTCAGAGTGGCATTCTGCATTTCTGTGGCTTCCAAGTCTTAGAACCTCAACTGACATATAGCATTGGGCACACTCCAGCAGACGCCCGAATTCAAATCCTGGAAGGATGGAAGAAACGCCTGGAGAATATTTGGGATGAGACACCACTGTATTTTGCTCCAAGCAGCC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... NQO1(1728) , NQO1(1728)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Brian Madajewski et al.
Molecular cancer research : MCR, 14(1), 14-25 (2015-11-11)
The fundamental role that NAD(P)H/quinone oxidoreductase 1 (NQO1) plays, in normal cells, as a cytoprotective enzyme guarding against stress induced by reactive oxygen species (ROS) is well documented. However, what is not known is whether the observed overexpression of NQO1
Xiang-Zhai Zhao et al.
OncoTargets and therapy, 11, 3609-3617 (2018-06-29)
Spindlactone A (SPL-A) is a novel small molecule inhibitor of TACC3 that selectively inhibits the nucleation of centrosome microtubules and induces mitotic arrest in ovarian cancer cells. SPL-A is derived from dicoumarol which inhibits the activity of NAD(P)H dehydrogenase quinone
Siriwoot Butsri et al.
Oncology letters, 13(6), 4540-4548 (2017-06-11)
We previously reported that upregulation of NAD(P)H:quinone oxidoreductase 1 (NQO1) in cholangiocarcinoma (CCA; a fatal bile duct cancer) was associated with poor prognosis. It was also demonstrated that the suppression of NQO1 was able to enhance the chemosensitivity of CCA
Masahiro Sekiguchi et al.
NPJ precision oncology, 4, 20-20 (2020-07-14)
Although hepatoblastoma is the most common pediatric liver cancer, its genetic heterogeneity and therapeutic targets are not well elucidated. Therefore, we conducted a multiomics analysis, including mutatome, DNA methylome, and transcriptome analyses, of 59 hepatoblastoma samples. Based on DNA methylation
Surendra Reddy Punganuru et al.
Cancers, 10(12) (2018-11-30)
Human NAD(P)H quinone oxidoreductase-1 (hNQO1) is an important cancer-related biomarker, which shows significant overexpression in malignant cells. Developing an effective method for detecting NQO1 activity with high sensitivity and selectivity in tumors holds a great potential for cancer diagnosis, treatment
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.