설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ATGCAATAACCACCCCTGACCCAACCACAAATGCCAGCCTGCTGACGAAGCTGCAGGCACAGAACCAGTGGCTGCAGGACATGACAACTCATCTCATTCTGCGCAGCTTTAAGGAGTTCCTGCAGTCCAGCCTGAGGGCTCTTCGGCAAATGTAGCATGGGCACCTCAGATTGTTGTTGTTAATGGGCATTCCTTCTTCTGGTCAGAAACCTGTCCACTGGGCACAGAACTTATGTTGTTCTCTATGGAGAACTAAAAGTATGAGCGTTAGGACACTATTTTAATTATTTTTAATTTATTAATATTTAAATATGTGAAGCTGAGTTAATTTATGTAAGTCATATTTATATTTTTAAGAAGTACCACTTGAAACATTTTATGTATTAGTTTTGAAATAATAATGGAAAGTGGCTATGCAGTTTGAATATCCTTTGTTTCAGAGCCAGATCATTTCTTGG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
관련 카테고리
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Eun-Ah Ye et al.
Vision research, 139, 15-22 (2017-04-24)
microRNA (miRNA) play critical roles in the pathological processes of diabetic retinopathy, including inflammatory responses, insulin signaling, and angiogenesis. In addition to their regulatory functions on gene expression, miRNA is considered as a potential therapeutic target, as well as a
Yaqi Yin et al.
Cell death & disease, 9(7), 760-760 (2018-07-11)
Progressive pancreatic β-cell dysfunction is recognized as a fundamental pathology of type 2 diabetes (T2D). Recently, mesenchymal stem cells (MSCs) have been identified in protection of islets function in T2D individuals. However, the underlying mechanisms remain elusive. It is widely
Shui-Fang Chen et al.
Molecular medicine reports, 16(3), 2733-2739 (2017-06-29)
Resistance to epidermal growth factor receptor (EGFR) inhibitors is of primary concern in the treatment of non‑small‑cell lung cancer (NSCLC) with EGFR mutations. To investigate the effects of matrine on H1975 cells and to examine a novel, potential treatment option for NSCLC
Hu Liu et al.
Biochemical and biophysical research communications, 486(2), 239-244 (2017-03-04)
Limited efficacy of immune checkpoint inhibitors in hepatocellular carcinoma (HCC) was observed in clinical trials, thus prompting investigation into combination therapy. Interleukin-6 (IL-6) has important roles in modeling immune responses in cancers. Here, we hypothesized that IL-6 blockade would enhance
Qiang Fu et al.
Cancer cell international, 17, 79-79 (2017-09-08)
Cisplatin has been used in the treatment of many cancers, including laryngeal cancer; however, its efficacy can be reduced due to the development of drug resistance. This study aimed to investigate whether interleukin-6 (IL-6) knockdown may enhance the efficacy of
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU046621-50UG | 4061831371741 |
| EHU046621-20UG | 4061831342840 |
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.