콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU046081

Sigma-Aldrich

MISSION® esiRNA

targeting human FAT1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

AATTGCTGACAACGCCTCTCCGAAGTTTACATCAAAAGAATATTCTGTTGAACTTAGTGAAACTGTCAGCATTGGGAGTTTCGTTGGGATGGTTACAGCCCATAGTCAATCATCAGTGGTGTATGAAATAAAAGATGGAAATACAGGTGATGCTTTTGATATTAATCCACATTCTGGAACTATCATCACTCAGAAAGCCCTGGACTTTGAAACTTTGCCCATTTACACATTGATAATACAAGGAACTAACATGGCTGGTTTGTCCACTAATACAACGGTTCTAGTTCACTTGCAGGATGAGAATGACAACGCGCCAGTTTTTATGCAGGCAGAATATACAGGACTCATTAGTGAATCAGCCTCAATTAACAGCGTGGTCCTAACAGACAGGAATGTCCCACTGG

Ensembl | 인체 수납 번호

ENSG00000083857

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... FAT1(2195) , FAT1(2195)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Xinhui Wu et al.
Cell biology international, 41(1), 24-32 (2016-10-21)
Porcine cumulus cells are localized around oocytes and act as a specific type of granulosa that plays essential roles in the development and maturation of oocytes, the development and atresia of follicles, and the development of embryos. Studies of FAT1
Evanka Madan et al.
International journal of cancer, 139(11), 2570-2582 (2016-08-19)
The hypoxic microenvironment is an important contributor of glioblastoma (GBM) aggressiveness via HIF1α, while tumour inflammation is profoundly influenced by FAT Atypical Cadherin (FAT1). This study was designed to explore the functional interaction and significance of FAT1 and HIF1α under
Andrey Sheyko et al.
Nature, 539(7630), 551-554 (2016-11-08)
A striking feature of many natural dynamos is their ability to undergo polarity reversals. The best documented example is Earth's magnetic field, which has reversed hundreds of times during its history. The origin of geomagnetic polarity reversals lies in a
Tung-Nien Hsu et al.
Cancers, 11(12) (2019-12-01)
FAT atypical cadherin 1 (FAT1) regulates cell-cell adhesion and extracellular matrix architecture, while acting as tumor suppressor or oncogene, context-dependently. Despite implication of FAT1 in several malignancies, its role in oral squamous cell carcinoma (OSCC) remains unclear. Herein, we document
Longyue L Cao et al.
Nature, 539(7630), 575-578 (2016-11-10)
Mitochondrial products such as ATP, reactive oxygen species, and aspartate are key regulators of cellular metabolism and growth. Abnormal mitochondrial function compromises integrated growth-related processes such as development and tissue repair, as well as homeostatic mechanisms that counteract ageing and

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.