콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU043821

Sigma-Aldrich

MISSION® esiRNA

targeting human RB1CC1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

ATGGCCAAGATTCCACTGTTGGAGTGCCTAACCAGACATAGTTACAGAGAATGTTTGGGAAGACTGGATTCTTTACCTGAACATGAAGACTCAGAAAAAGCTGAGATGAAAAGATCCACTGAACTGGTGCTCTCTCCTGATATGCCTAGAACAACTAACGAATCTTTGTTAACCTCATTTCCCAAGTCAGTGGAACATGTGTCCCCAGATACCGCAGATGCTGAAAGTGGCAAAGAAATTAGGGAATCTTGTCAAAGTACTGTTCATCAGCAAGATGAAACTACGATTGACACTAAAGATGGTGATCTGCCCTTTTTTAATGTCTCTTTGTTAGACTGGATAAATGTTCAAGATAGACCTAATGATGTGGAATCTTTGGTCAGGAAGTGCTTTGATTCTATGAGCAGGCTTGATCCAAGGATTATTCGACCATTTATAGCAGAATGCCGTCAAACTATTGCC

Ensembl | 인체 수납 번호

ENSG00000023287

NCBI 수납 번호

NM_014781

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... RB1CC1(9821) , RB1CC1(9821)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Ingrid Kjos et al.
EMBO reports, 18(10), 1727-1739 (2017-08-25)
Autophagy (macroautophagy) is a highly conserved eukaryotic degradation pathway in which cytosolic components and organelles are sequestered by specialized autophagic membranes and degraded through the lysosomal system. The autophagic pathway maintains basal cellular homeostasis and helps cells adapt during stress;
Aykut Turan et al.
The Journal of cell biology, 218(2), 508-523 (2018-12-28)
Dendritic cells (DCs) are crucial for the induction of potent antiviral immune responses. In contrast to immature DCs (iDCs), mature DCs (mDCs) are not permissive for infection with herpes simplex virus type 1 (HSV-1). Here, we demonstrate that HSV-1 infection
Eleonora Turco et al.
Molecular cell, 74(2), 330-346 (2019-03-12)
The autophagy cargo receptor p62 facilitates the condensation of misfolded, ubiquitin-positive proteins and their degradation by autophagy, but the molecular mechanism of p62 signaling to the core autophagy machinery is unclear. Here, we show that disordered residues 326-380 of p62
Takashi Nozawa et al.
Nature communications, 11(1), 770-770 (2020-02-09)
Invading microbial pathogens can be eliminated selectively by xenophagy. Ubiquitin-mediated autophagy receptors are phosphorylated by TANK-binding kinase 1 (TBK1) and recruited to ubiquitinated bacteria to facilitate autophagosome formation during xenophagy, but the molecular mechanism underlying TBK1 activation in response to
Tomokazu Murakawa et al.
Cell reports, 26(2), 338-345 (2019-01-10)
Degradation of mitochondria by selective autophagy, termed mitophagy, contributes to the control of mitochondrial quality. Bcl2-L-13 is a mammalian homolog of Atg32, which is an essential mitophagy receptor in yeast. However, the molecular machinery involved in Bcl2-L-13-mediated mitophagy remains to

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.