콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU043071

Sigma-Aldrich

MISSION® esiRNA

targeting human XRN1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GACATCCGAGCTTTCGACTCCCGTTTCTCCAATATCAAAACATTGGATGATTTGTTTCCTCTGAGAAGTATGGTCTTTATGCTGGGAACTCCCTATTATGGCTGCACTGGAGAAGTTCAGGATTCAGGTGATGTGATTACAGAAGGTAGGATTCGTGTGATTTTCAGCATTCCATGTGAACCCAATCTTGATGCTTTAATACAGAACCAGCATAAATATTCTATAAAGTACAACCCAGGATATGTGTTGGCCAGTCGCCTTGGAGTGAGTGGATACCTTGTTTCAAGGTTTACAGGAAGTATTTTTATTGGAAGAGGATCTAGGAGAAACCCTCATGGAGACCATAAAGCAAATGTGGGTTTAAATCTCAAATTCAACAAGAAAAATGAGGAGGTACCTGGATATACTAAGAAAGTTGGAAGTGAATGGATGTATTCATCTGCAGCAGAACAACTTCTGGCA

Ensembl | 인체 수납 번호

ENSG00000114127

NCBI 수납 번호

NM_019001

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... XRN1(54464) , XRN1(54464)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
HRX
HXR

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Joséphine Zangari et al.
Nucleic acids research, 45(7), 4131-4141 (2016-12-21)
Extracellular vesicles (EVs) have been shown to play an important role in intercellular communication as carriers of DNA, RNA and proteins. While the intercellular transfer of miRNA through EVs has been extensively studied, the stability of extracellular miRNA (ex-miRNA) once
Rodney P Kincaid et al.
Proceedings of the National Academy of Sciences of the United States of America, 115(32), 8197-8202 (2018-07-25)
Seventy percent of people infected with hepatitis C virus (HCV) will suffer chronic infection, putting them at risk for liver disease, including hepatocellular carcinoma. The full range of mechanisms that render some people more susceptible to chronic infection and liver
Shin-Ichiro Hori et al.
Biochemical and biophysical research communications, 464(2), 506-511 (2015-07-15)
Antisense oligonucleotides (ASOs) can suppress the expression of a target gene by cleaving pre-mRNA and/or mature mRNA via RNase H1. Following the initial endonucleolytic cleavage by RNase H1, the target RNAs are degraded by a mechanism that is poorly understood.
Oussama Meziane et al.
Scientific reports, 5, 16688-16688 (2015-11-21)
The decapping scavenger enzyme DcpS is known for its role in hydrolyzing the cap structure following mRNA degradation. Recently, we discovered a new function in miRNA degradation activation for the ortholog of DcpS in C. elegans. Here we show that

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.