추천 제품
설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CCACTGAGTCATGCGACTTCGTGCGGGCCATGGTGGACCCGGCCCAGACGGTGGAACAGAGGCTGAAGTTGTTCAAGTTGGCGTCTGAGAAGCATCAGCATATGTATCGCCTCGCCATGACCGGCTCTGGGATCGATCGTCACCTCTTCTGCCTTTACGTGGTGTCTAAATATCTCGCTGTGGAGTCCCCTTTCCTTAAGGAAGTTTTATCTGAGCCTTGGAGATTATCAACAAGCCAGACCCCTCAGCAGCAAGTGGAGCTGTTTGACTTGGAGAATAACCCAGAGTACGTGTCCAGCGGAGGGGGCTTTGGACCGGTTGCTGATGACGGCTATGGTGTGTCGTACATCCTTGTGGGAGAGAACCTCATCAATTTCCACATTTCTTCCAAGTTCTCTTGCCCTGAG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... CPT1A(1374) , CPT1A(1374)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Jin Seok et al.
Stem cell research & therapy, 11(1), 1-1 (2020-01-05)
Human placenta-derived mesenchymal stem cells (PD-MSCs) are powerful sources for cell therapy in regenerative medicine. However, a limited lifespan by senescence through mechanisms that are well unknown is the greatest obstacle. In the present study, we first demonstrated the characterization
Hideki Iwamoto et al.
Cell metabolism, 28(1), 104-117 (2018-06-05)
Intrinsic and evasive antiangiogenic drug (AAD) resistance is frequently developed in cancer patients, and molecular mechanisms underlying AAD resistance remain largely unknown. Here we describe AAD-triggered, lipid-dependent metabolic reprogramming as an alternative mechanism of AAD resistance. Unexpectedly, tumor angiogenesis in adipose
Seher Balaban et al.
Molecular cancer research : MCR, 17(4), 949-962 (2019-01-17)
Prostate cancer cells exhibit altered cellular metabolism but, notably, not the hallmarks of Warburg metabolism. Prostate cancer cells exhibit increased de novo synthesis of fatty acids (FA); however, little is known about how extracellular FAs, such as those in the
Trang Thi Thu Nguyen et al.
The Journal of clinical investigation, 130(7), 3699-3716 (2020-04-22)
The Warburg effect is a tumor-related phenomenon that could potentially be targeted therapeutically. Here, we showed that glioblastoma (GBM) cultures and patients' tumors harbored super-enhancers in several genes related to the Warburg effect. By conducting a transcriptome analysis followed by
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.