설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GGGAGCTGCCATTAAGATCATTCGGCAGTTAATGGAGAAGTTTAACTTGGATCTATCAACAGTTACACAGGCCTTCCTAAAAAATAGTGGTGAGCTGGAGGCTACTTCCGCCTTCTTAGCGTCTGGTCAGAGAGCTGATGGATATCCCATTTGGTCCCGACAAGATGACATAGATTTGCAAAAAGATGATGAGGATACCAGAGAGGCATTGGTCAAAAAATTTGGTGCTCAGAATGTAGCTCGGAGGATTGAATTTCGAAAGAAATAATTGGCAAGATAATGAGAAAAGAAAAAAGTCATGGTAGGTGAGGTGGTTAAAAAAAATTGTGACCAATGAACTTTAGAGAGTTCTTGCATTGGAACTGGCACTTATTTTCTGACCATCGCTGCTGTTGCTCTGTGAGTCC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... TERF2IP(54386) , TERF2IP(54386)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Infection and immunity, 82(9), 3802-3810 (2014-07-02)
Caseinolytic protease L (ClpL) is a member of the HSP100/Clp chaperone family, which is found mainly in Gram-positive bacteria. ClpL is highly expressed during infection for refolding of stress-induced denatured proteins, some of which are important for adherence. However, the
Reproduction (Cambridge, England), 147(6), 897-906 (2014-03-04)
The optimal decidualization of endometrial stromal cells (ESCs) following embryo implantation is one of the critical steps to establish pregnancy in rodents and humans. This step is intricately regulated by ovarian hormones. Using in vitro human ESCs model, we previously
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.