설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TATGCTCCAAAGGCAAGGTCTTAGACCTATTCCTGAAGCAGAAATTGGATTGGCGGTGATTTTCATGACTACAAAGAATTACTGTGATCCTCAGGGCCATCCCAGTACAGGATTAAAGACAACAACTCCAGGACCAAGCCTTTCACAAGGCGTGTCAGTTGATGAAAAACTAATGCCAAGCGCCCCAGTGAACACTACAACATACGTAGCTGACACAGAATCAGAGCAAGCAGATACATGGGATTTGAGTGAAAGGCCAAAAGAAATCAAAGTCTCCAAAATGGAACAAAAATTCAGAATGCTTTCACAAGATGCACCCACTGTAAAGGAGTCCTGCAAAACAAGCTCTAATAATAATAGTATGGTATCAAATACTTTGGCTAAGATGAGAATCCCAAACTATCAGCTTTCACCAACTAAATTGCCAAGTATAAATAAAAGTAAAGATAGGGCTTCTCAGCAGCAG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Katie Myers et al.
PLoS genetics, 5(1), e1000324-e1000324 (2009-01-03)
The related PIK-like kinases Ataxia-Telangiectasia Mutated (ATM) and ATM- and Rad3-related (ATR) play major roles in the regulation of cellular responses to DNA damage or replication stress. The pro-apoptotic role of ATM and p53 in response to ionizing radiation (IR)
Artem K Velichko et al.
Nucleic acids research, 47(13), 6811-6825 (2019-05-23)
The contribution of nucleoli to the cellular stress response has been discussed for over a decade. Stress-induced inhibition of RNA polymerase I-dependent transcription is hypothesized as a possible effector program in such a response. In this study, we report a
Daniel C Anacker et al.
Journal of virology, 88(15), 8528-8544 (2014-05-23)
Activation of the ATM (ataxia telangiectasia-mutated kinase)-dependent DNA damage response (DDR) is necessary for productive replication of human papillomavirus 31 (HPV31). We previously found that DNA repair and homologous recombination (HR) factors localize to sites of HPV replication, suggesting that
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.