설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ACCTTGTTCCAATCCCAGGTGGAATGAATGGCTGAATTATGATATATACATTCCTGATCTTCCTCGTGCTGCTCGACTTTGCCTTTCCATTTGCTCTGTTAAAGGCCGAAAGGGTGCTAAAGAGGAACACTGTCCATTGGCATGGGGAAATATAAACTTGTTTGATTACACAGACACTCTAGTATCTGGAAAAATGGCTTTGAATCTTTGGCCAGTACCTCATGGATTAGAAGATTTGCTGAACCCTATTGGTGTTACTGGATCAAATCCAAATAAAGAAACTCCATGCTTAGAGTTGGAGTTTGACTGGTTCAGCAGTGTGGTAAAGTTCCCAGATATGTCAGTGATTGAAGAGCATGCCAATTGGTCTGTATCCCGAGAAGCAGGATTTAGCTATTCCCACGCAGG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... PIK3CA(5290) , PIK3CA(5290)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Xiuling Liang et al.
Yonsei medical journal, 60(2), 182-190 (2019-01-23)
This study aimed to investigate the effects of PIK3CA on the sensitivity of acute B lymphocytic leukemia cells (Nalm-6 cells) to chemotherapy drugs. Children's normal B lymphocytes and Nalm-6 cells were cultured. Nalm-6 cells were transfected with PIK3CA siRNA (siPIK3CA
Shuke Ge et al.
Oncology research, 25(8), 1363-1371 (2017-03-02)
miR-152, as a tumor suppressor, has been reported to be downregulated in a number of cancer cell lines and tumor tissues, including breast cancer. This study aimed to investigate the role of miR-152 in human breast cancer and its underlying
Zhao Wang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 43(6), 2505-2515 (2017-11-14)
Numerous studies have demonstrated that aberrant microRNA (miRNA) expression is involved in human disease including cancer. To date, the potential miRNAs regulating lung cancer growth and progression are not fully identified yet. In this study, the expression of miR-142-5p was
Jun Xu et al.
Molecular medicine reports, 12(3), 4708-4712 (2015-06-24)
The expression of osteopontin (OPN) and vascular endothelial growth factor (VEGF) are associated with the severity of cartilage destruction in osteoarthritis. However, the biological connection between OPN and VEGF in osteoarthritis remains to be elucidated. The present study was performed
Zhenyou Zou et al.
Journal of drug targeting, 22(9), 839-848 (2014-07-16)
Multi-drug resistance (MDR) cancer is an intractable problem. Over-expression of drug efflux transporters such as ABCB1, ABCC1 and ABCG2 contributes to it, by which they pump drugs out of cells, and result in the decrease in the efficacy of chemotherapy.
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.