콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU037471

Sigma-Aldrich

MISSION® esiRNA

targeting human ECT2

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TTTGGATTCTCCGGAATTTGAAAATGTATTTGTAGTCACGGACTTTCAGGATTCTGTCTTTAATGACCTCTACAAGGCTGATTGTAGAGTTATTGGACCACCAGTTGTATTAAATTGTTCACAAAAAGGAGAGCCTTTGCCATTTTCATGTCGCCCGTTGTATTGTACAAGTATGATGAATCTAGTACTATGCTTTACTGGATTTAGGAAAAAAGAAGAACTAGTCAGGTTGGTGACATTGGTCCATCACATGGGTGGAGTTATTCGAAAAGACTTTAATTCAAAAGTTACACATTTGGTGGCAAATTGTACACAAGGAGAAAAATTCAGGGTTGCTGTGAGTCTAGGTACTCCAATTATGAAGCCAGAATGGATTTATAAAGCTTGGGAAAGGCGGAATGAACAGGAT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Zheng-Qing Fang et al.
Journal of cellular biochemistry, 119(10), 8317-8324 (2018-06-23)
We intended to evaluate miR-490-5p expression in hepatocellular carcinoma (HCC) tissues and detect the potential targets of miR-490-5p. In vitro experiments were conducted to further investigate the biological function of miR-490-5p on HCC cell metastasis. We investigated the abnormally expressed
Zeinab Kosibaty et al.
Laboratory investigation; a journal of technical methods and pathology, 99(4), 551-567 (2018-12-14)
Epithelial cell transforming sequence 2 (ECT2), a guanine nucleotide exchange factor, is predominantly localized in the nucleus of non-transformed cells and functions to regulate cytokinesis. ECT2 is also localized in the cytoplasm of cancer cells. Aberrant cytoplasmic expression of ECT2
J Sebastián Gómez-Cavazos et al.
Current biology : CB, 30(16), 3101-3115 (2020-07-04)
Cytokinesis partitions the cell contents to complete mitosis. During cytokinesis, polo-like kinase 1 (PLK1) activates the small GTPase RhoA to assemble a contractile actomyosin ring. PLK1 is proposed to pattern RhoA activation by creating a docking site on the central

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.