콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU037321

Sigma-Aldrich

MISSION® esiRNA

targeting human SMAD7

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GTGGCATACTGGGAGGAGAAGACGAGAGTGGGGAGGCTCTACTGTGTCCAGGAGCCCTCTCTGGATATCTTCTATGATCTACCTCAGGGGAATGGCTTTTGCCTCGGACAGCTCAATTCGGACAACAAGAGTCAGCTGGTGCAGAAGGTGCGGAGCAAAATCGGCTGCGGCATCCAGCTGACGCGGGAGGTGGATGGTGTGTGGGTGTACAACCGCAGCAGTTACCCCATCTTCATCAAGTCCGCCACACTGGACAACCCGGACTCCAGGACGCTGTTGGTACACAAGGTGTTCCCCGGTTTCTCCATCAAGGCTTTCGACTACGAGAAGGCGTACAGCCTGCAGCGGCCCAATGACCACGAGTTTATGCAGCAGCCGTGGACGGGCTTTACCGTGCAGATCAGCTTTG

Ensembl | 인체 수납 번호

ENSG00000101665

NCBI 수납 번호

NM_005904

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... SMAD7(4092) , SMAD7(4092)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
XWU
BNU
JLU
QCS
HKU

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Takashi Emori et al.
Biology open, 1(3), 247-260 (2012-12-06)
Smad family proteins are essential intracellular mediators that regulate transforming growth factor-β (TGF-β) ligand signaling. In response to diverse stimuli, Smad7 is rapidly expressed and acts as a cytoplasmic inhibitor that selectively interferes with signals elicited from TGF-β family receptors.
Tianming Liu et al.
Oncology letters, 14(4), 3941-3946 (2017-09-26)
MicroRNA (miR)-590 has been established to be a promoter of cell proliferation, migration and invasion, and an inhibitor of apoptosis in numerous cancer cell lines. However, its effects on non-cancer cells remain to be elucidated. miR-590 was transfected into human
Ratana Lim et al.
Biology of reproduction, 97(2), 288-301 (2017-10-19)
Preterm birth continues to be a significant public health problem. Infection (bacterial and or viral) and inflammation, by stimulating proinflammatory cytokines, adhesion molecules, and matrix metalloproteinase 9 (MMP9), play a central role in the rupture of membranes and myometrial contractions.
Lili Du et al.
Cardiology, 138(1), 55-62 (2017-06-02)
Eplerenone (EPL), an antagonist of the mineralocorticoid receptor, is beneficial for atrial fibrillation and atrial fibrosis. However, the underlying mechanism remains less well known. We aimed to investigate the effect of EPL on atrial fibrosis using a mouse with selective
R B Luwor et al.
Oncogene, 32(19), 2433-2441 (2012-07-04)
Transforming Growth Factor-β (TGF-β) and Epidermal Growth Factor (EGF) signaling pathways are both independently implicated as key regulators in tumor formation and progression. Here, we report that the tumor-associated overexpression of epidermal growth factor receptor (EGFR) desensitizes TGF-β signaling and
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.