설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TGCATGGCATGGATTTATTGGTCTTATTGGATTTGATTGGAGCTCCAAACCCAACGTTTCCCAATTTTTTTCCAAACTCAGCCAGGTGGTTCGAAAGACTTCAAGCAATTGAACATGAACTTCATGAATTGGGTTTGCTCAAGGATCACTCTTTGGAGGGGCGGTATTTCCAGAATTACAGTTATGGAGGTGTGATTCAGGATGACCATATTCCATTTTTAAGAAGAGGTGTTCCAGTTCTGCATCTGATACCGTCTCCTTTCCCTGAAGTCTGGCACACCATGGATGACAATGAAGAAAATTTGGATGAATCAACCATTGACAATCTAAACAAAATCCTACAAGTCTTTGTGTTGGAATATCTTCATTTGTAATACTCTGATTTAGTTTAGGATAATTGGTTCTAGAATTGAATTCAAAAGTCAAGGCATCATTTAAAATAATCTGATTTCAGACAAATGCTGTGTGGA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... QPCT(25797) , QPCT(25797)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Tangliang Zhao et al.
Theranostics, 9(21), 6175-6190 (2019-09-20)
Rationale: Although sunitinib has been shown to improve the survival rate of advanced renal cell carcinoma (RCC) patients, poor drug response is a major challenge that reduces patient benefit. It is important to elucidate the underlying mechanism so that the
Sumegha Mitra et al.
PloS one, 9(6), e100169-e100169 (2014-06-19)
Growth arrest DNA damage inducible alpha (GADD45a) is a stress-induced gene we have shown to participate in the pathophysiology of ventilator-induced lung injury (VILI) via regulation of mechanical stress-induced Akt ubiquitination and phosphorylation. The regulation of GADD45a expression by mechanical
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.