콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU035471

Sigma-Aldrich

MISSION® esiRNA

targeting human PNPLA2

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GGTGCCAAGTTCATTGAGGTATCTAAAGAGGCCCGGAAGCGGTTCCTGGGCCCCCTGCACCCCTCCTTCAACCTGGTAAAGATCATCCGCAGTTTCCTGCTGAAGGTCCTGCCTGCTGATAGCCATGAGCATGCCAGTGGGCGCCTGGGCATCTCCCTGACCCGCGTGTCAGACGGCGAGAATGTCATTATATCCCACTTCAACTCCAAGGACGAGCTCATCCAGGCCAATGTCTGCAGCGGTTTCATCCCCGTGTACTGTGGGCTCATCCCTCCCTCCCTCCAGGGGGTGCGCTACGTGGATGGTGGCATTTCAGACAACCTGCCACTCTATGAGCTTAAGAACACCATCACAGTGTCCCCCTTCTCGGGCGAGAGTGACATCTGTCCGCAGGACAGCTCCACCAACATC

Ensembl | 인체 수납 번호

ENSG00000177666

NCBI 수납 번호

NM_020376

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... PNPLA2(57104) , PNPLA2(57104)

관련 카테고리

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yosuke Kanno et al.
Arthritis research & therapy, 19(1), 22-22 (2017-02-06)
Systemic sclerosis (SSc) is a connective tissues disease of unknown origin characterized by vascular damage and extensive fibrosis. Recently, we demonstrated that α2-antiplasmin (α2AP) is associated with the development of fibrosis in SSc. We herein investigate the roles of α2AP
Monika Riederer et al.
Archives of physiology and biochemistry, 123(4), 249-253 (2017-04-04)
Vascular endothelial cells represent an important source of arachidonic acid (AA)-derived mediators involved in the generation of anti- or proatherogenic environments. Evidence emerged (in mast cells), that in addition to phospholipases, neutral lipid hydrolases as adipose triglyceride lipase (ATGL) also
Tian Ma et al.
International journal of oncology, 42(5), 1743-1753 (2013-04-03)
The G0/G1 switch gene 2 (G0S2) is rapidly induced by all-trans-retinoic acid (RA)-treatment of acute promyelocytic leukemia (APL) and other cells. G0S2 regulates lipolysis via inhibition of adipose triglyceride lipase (ATGL). This study found that retinoic acid receptor (RAR), but
Susanne Bürger et al.
International journal of molecular sciences, 22(1) (2021-01-06)
The demise of retinal ganglion cells (RGCs) is characteristic of diseases of the retina such as glaucoma and diabetic or ischemic retinopathies. Pigment epithelium-derived factor (PEDF) is a multifunctional secreted protein that mediates neuroprotection and inhibition of angiogenesis in the
Ping Xie et al.
Endocrinology, 156(5), 1648-1658 (2015-03-10)
Intramyocellular accumulation of lipids is often associated with insulin resistance. Deficiency of comparative gene identification-58 (CGI-58) causes cytosolic deposition of triglyceride (TG)-rich lipid droplets in most cell types, including muscle due to defective TG hydrolysis. It was unclear, however, whether
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.