추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GCACCTTGGACATCTGGAGTCTGGCAGGGTTTGATCCCAGGGCCTGGGCAACGGAGGTGTAGCTGGCAGCAGCGGGCAGGTGAGGACCCCATCTGCCGGGCAGGTGAGTCCCTTCCCTCCCCAGGCCTCGCTTCCCCAGCCTTCTGAAAGAAGGAGGTTTAGGGGATCGAGGGCTGGCGGGGAGAAGCAGACACCCTCCCAGCAGAGGGGCAGGATGGGGGCAGGAGAGTTAGCAAAGGTGACATCTTCTCGGGGGGAGCCGAGACTGCGCAAGGCTGGGGGGTTATGGGCCCGTTCCAGGCAGAAAGAGCAAGAGGGCAGGGAGGGAGCACAGGGGTGGCCAGCGTAGGGTCCAGCACGTGGGGTGGTACCCCAGGCCTGGGTCAGACAGGGACATGGCAGGGGACACAGGACAGAGGGGTCCCCAGCTGCCACCTCACCCACCGCAATTCATTTAGTAGCAGGCACAGGGG
Ensembl | 인체 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... H19(10188)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Vinay Shivanna et al.
Virology, 483, 218-228 (2015-05-20)
Our recent results demonstrated that bile acids facilitate virus escape from the endosomes into the cytoplasm for successful replication of porcine enteric calicivirus (PEC). We report a novel finding that bile acids can be substituted by cold treatment for endosomal
A Bai et al.
Cell death & disease, 6, e1828-e1828 (2015-07-24)
Acid sphingomyelinase (ASM), a lipid hydrolase enzyme, has the potential to modulate various cellular activation responses via the generation of ceramide and by interaction with cellular receptors. We have hypothesized that ASM modulates CD4(+) T-cell receptor activation and impacts immune
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.