설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TCTGTTCTCAGCGTCAGTGCCGCCACTGCCCCCGCCAGAGCCCACCGGCCAGCATGTCCTCTGCTCACTTCAACCGAGGCCCTGCCTACGGGCTGTCAGCCGAGGTTAAGAACAAGCTGGCCCAGAAGTATGACCACCAGCGGGAGCAGGAGCTGAGAGAGTGGATCGAGGGGGTGACAGGCCGTCGCATCGGCAACAACTTCATGGACGGCCTCAAAGATGGCATCATTCTTTGCGAATTCATCAATAAGCTGCAGCCAGGCTCCGTGAAGAAGATCAATGAGTCAACCCAAAATTGGCACCAGCTGGAGAACATCGGCAACTTCATCAAGGCCATCACCAAGTATGGGGTGAAGCCCCACGACATTTTTGAGGCCAACGACCTGTTTGAGAACACCAACCATACACAGGTGCAGTCCACCCTCCTGGCTTTGGCCAGCATGGCGAAGACGAAAGGAAACAAGGTGAACGTGG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... CNN1(1264) , CNN1(1264)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Zheng Wang et al.
Aging, 12(2), 1867-1887 (2020-01-28)
Breast cancer has been the second most prevalent and fatal malignancy due to its frequent metastasis to other organs. We aim to study the effects of a key miRNA-mRNA signaling in breast cancer. CNN1 was identified as the key gene
Kai-Hung Wang et al.
Oncotarget, 8(37), 61133-61145 (2017-10-06)
Increasing evidence indicates that ovarian high-grade serous carcinoma (HGSC) originates from the fallopian tube epithelium and metastasizes to the ovary as the secondary site. A working hypothesis is that detached tubal HGSC cells survive anoikis and implant on the ovary.
Janhavi Moharil et al.
PloS one, 10(10), e0141365-e0141365 (2015-10-28)
Stem cell differentiation involves multiple cascades of transcriptional regulation that govern the cell fate. To study the real-time dynamics of this complex process, quantitative and high throughput live cell assays are required. Herein, we developed a lentiviral library of promoters
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.