설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GCTGGCTGTAAGTGGTCTCCGTCCTGTCCAGGCCCAGGCCCAGAGCGATTGCAGTTGCTCTACGGTGAGCCCGGGCGTGCTGGCAGGGATCGTGATGGGAGACCTGGTGCTGACAGTGCTCATTGCCCTGGCCGTGTACTTCCTGGGCCGGCTGGTCCCTCGGGGGCGAGGGGCTGCGGAGGCAGCGACCCGGAAACAGCGTATCACTGAGACCGAGTCGCCTTATCAGGAGCTCCAGGGTCAGAGGTCGGATGTCTACAGCGACCTCAACACACAGAGGCCGTATTACAAATGAGCCCGAATCATGACAGTCAGCAACATGATACCTGGATCCAGCCATTCCTGAAGCCCACCCTGCACCTCATTCCAACTCCTACCGCGATACAGACCCACAGAGTGCCATCCCTGAGAGA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... TYROBP(7305) , TYROBP(7305)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Neuropsychopharmacology : official publication of the American College of Neuropsychopharmacology, 39(13), 2949-2962 (2014-07-23)
Triggering receptor expressed on myeloid cells 2 (TREM2) gene is a recently identified susceptibility gene for Alzheimer's disease (AD), as its low-frequency variants increase the risk of this disease with an odds ratio similar to that of an APOE ɛ4
Arthritis research & therapy, 14(6), R245-R245 (2012-11-14)
The immunoreceptor tyrosine-based activation motif (ITAM) pathway provides osteoclast co-stimulatory signals and regulates proliferation, survival and differentiation of effector immune cells. In the osteoclast, the receptors Triggering Receptor Expressed on Myeloid cells 2 (TREM2) and Osteoclast Associated Receptor (OSCAR) and
Cellular & molecular immunology, 16(5), 460-472 (2018-03-24)
The triggering receptor expressed on myeloid cells-1 (TREM-1) is a receptor expressed on innate immune cells. By promoting the amplification of inflammatory signals that are initially triggered by Toll-like receptors (TLRs), TREM-1 has been characterized as a major player in
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.