콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU032931

Sigma-Aldrich

MISSION® esiRNA

targeting human P4HB

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CATCGTGAACTGGCTGAAGAAGCGCACGGGCCCGGCTGCCACCACCCTGCCTGACGGCGCAGCTGCAGAGTCCTTGGTGGAGTCCAGCGAGGTGGCTGTCATCGGCTTCTTCAAGGACGTGGAGTCGGACTCTGCCAAGCAGTTTTTGCAGGCAGCAGAGGCCATCGATGACATACCATTTGGGATCACTTCCAACAGTGACGTGTTCTCCAAATACCAGCTCGACAAAGATGGGGTTGTCCTCTTTAAGAAGTTTGATGAAGGCCGGAACAACTTTGAAGGGGAGGTCACCAAGGAGAACCTGCTGGACTTTATCAAACACAACCAGCTGCCCCTTGTCATCGAGTTCACCGAGCAGACAGCCCCGAAGATTTTTGGAGGTGAAATCAAGACTCACATCCTGCTGTTCTTGC

Ensembl | 인체 수납 번호

ENSG00000185624

NCBI 수납 번호

NM_000918

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... P4HB(5034) , P4HB(5034)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Wei Xia et al.
Oncotarget, 8(5), 8512-8521 (2017-01-05)
P4HB and GRP78 are molecular chaperones involved in cellular response to ER stress. They have been linked to cancer progression; however, their roles in hepatocellular carcinoma (HCC) are largely unclear. In this study, we found that P4HB is overexpressed in
Rashed Alhammad et al.
Oncology reports, 44(6), 2406-2418 (2020-10-31)
Oxidoreductase protein disulphide isomerases (PDI) are involved in the regulation of a variety of biological processes including the modulation of endoplasmic reticulum (ER) stress, unfolded protein response (UPR), ER‑mitochondria communication and the balance between pro‑survival and pro‑death pathways. In the
Xiu-Juan Ding et al.
Theranostics, 10(24), 11110-11126 (2020-10-13)
Rationale: Many external factors can induce the melanogenesis and inflammation of the skin. Salidroside (SAL) is the main active ingredient of Rhodiola, which is a perennial grass plant of the Family Crassulaceae. This study evaluated the effect and molecular mechanism
Yajing Liu et al.
Cancer research, 79(11), 2923-2932 (2019-04-19)
Patients with glioblastoma multiforme (GBM) survive on average 12 to 14 months after diagnosis despite surgical resection followed by radiotheraphy and temozolomide therapy. Intrinsic or acquired resistance to chemo- and radiotherapy is common and contributes to a high rate of

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.