설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CTTTCGGATACCGAGCTGACCACCTTGCTGCGCCGGTACAACATCCCGCACGGGCCTGTAGTAGGATCAACTCGTAGGCTTTACGAGAAGAAGATCTTCGAGTACGAGACCCAGAGGCGGCGGCTCTCGCCCCCCAGCTCGTCCGCCGCCTCCTCTTATAGCTTCTCTGACTTGAATTCGACTAGAGGGGATGCAGATATGTATGATCTTCCCAAGAAAGAGGACGCTTTACTCTACCAGAGCAAGGGCTACAATGACGACTACTATGAAGAGAGCTACTTCACCACCAGGACTTATGGGGAGCCCGAGTCTGCCGGCCCGTCCAGGGCTGTCCGCCAGTCAGTGACTTCATTCCCAGATGCTGACGCTTTCCATCACCAGGTGCATGATGACGATCTTTTGTCTTCTTCTGAAGAGGAGTGCAAGGATAGGGAACGCCCCATGTACGGCCGGGACAGTGCCTACCAGAGCATCA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Mariana Reis-Sobreiro et al.
Cancer research, 78(21), 6086-6097 (2018-08-30)
Abnormalities in nuclear shape are a well-known feature of cancer, but their contribution to malignant progression remains poorly understood. Here, we show that depletion of the cytoskeletal regulator, Diaphanous-related formin 3 (DIAPH3), or the nuclear membrane-associated proteins, lamin A/C, in
Amar N Mirza et al.
Cell, 176(1-2), 198-212 (2018-12-07)
Understanding transcription factor navigation through the nucleus remains critical for developing targeted therapeutics. The GLI1 transcription factor must maintain maximal Hedgehog pathway output in basal cell carcinomas (BCCs), and we have previously shown that resistant BCCs increase GLI1 deacetylation through
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.