콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU032271

Sigma-Aldrich

MISSION® esiRNA

targeting human IKBKG

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CACTCCCTGTGAAGCTCTCCAGCATCATCGAGGTCCCATCAGGTGGGGAAAGATGCTGTTCCAGGCGCACACTAGTCTACAAGGCCAGAGCTTTCTGGAAGGGGGCACCCTTGCCCTGTTGGATGAATAGGCACCTCTGGAAGAGCCAACTGTGTGAGATGGTGCAGCCCAGTGGTGGCCCGGCAGCAGATCAGGACGTACTGGGCGAAGAGTCTCCTCTGGGGAAGCCAGCCATGCTGCACCTGCCTTCAGAACAGGGCGCTCCTGAGACCCTCCAGCGCTGCCTGGAGGAGAATCAAGAGCTCCGAGATGCCATCCGGCAGAGCAACCAGATTCTGCGGGAGCGCTGCGAGGAGCTTCTGCATTTCCAAGCCAGCCAGAGGGAGGAGAAGGAGTTCCTCATGTGCAAGTTCCAGGAGGCCAGGAAACTGGTGGAGAGACTCGGCCTGGAGAAGCTCGATCTGAAGAGGCAGAAGG

Ensembl | 인체 수납 번호

ENSG00000073009

NCBI 수납 번호

NM_003639

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... IKBKG(8517) , IKBKG(8517)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jérôme Bouchet et al.
Journal of immunology (Baltimore, Md. : 1950), 198(7), 2967-2978 (2017-02-27)
The role of endosomes in receptor signal transduction is a long-standing question, which remains largely unanswered. The T cell Ag receptor and various components of its proximal signaling machinery are associated with distinct endosomal compartments, but how endosomal traffic affects
Sona Hubackova et al.
Aging, 4(12), 932-951 (2013-02-07)
Many cancers arise at sites of infection and inflammation. Cellular senescence, a permanent state of cell cycle arrest that provides a barrier against tumorigenesis, is accompanied by elevated proinflammatory cytokines such as IL1, IL6, IL8 and TNFα. Here we demonstrate
Verena Quennet et al.
Nucleic acids research, 39(6), 2144-2152 (2010-11-20)
Topoisomerases class II (topoII) cleave and re-ligate the DNA double helix to allow the passage of an intact DNA strand through it. Chemotherapeutic drugs such as etoposide target topoII, interfere with the normal enzymatic cleavage/re-ligation reaction and create a DNA
Yu Gang Liu et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(4), 5018-5033 (2019-01-01)
Cathepsin C (CtsC) functions as a central coordinator for activation of many serine proteases in immune cells. However, CtsC expression in gastric epithelial cells and its role in Helicobacter pylori infection remain unclear. Real-time PCR, Western blot, and immunohistochemistry analyses
Yun Chen et al.
PloS one, 9(5), e98483-e98483 (2014-05-24)
Previous studies showed that prostacyclin inhibited fibrosis. However, both receptors of prostacyclin, prostacyclin receptor (IP) and peroxisome proliferator-activated receptor (PPAR), are abundant in cardiac fibroblasts. Here we investigated which receptor was vital in the anti-fibrosis effect of prostacyclin. In addition

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.