콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU031291

Sigma-Aldrich

MISSION® esiRNA

targeting human DKC1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TGTGTGCACCTTGGTTTGTTATTGGGAGTTGGTGGTCAGATGCAGGAGCTTCGGAGGGTTCGTTCTGGAGTCATGAGTGAAAAGGACCACATGGTGACAATGCATGATGTGCTTGATGCTCAGTGGCTGTATGATAACCACAAGGATGAGAGTTACCTGCGGCGAGTTGTTTACCCTTTGGAAAAGCTGTTGACATCTCATAAACGGCTGGTTATGAAAGACAGTGCAGTAAATGCCATCTGCTATGGGGCCAAGATTATGCTTCCAGGTGTTCTTCGATATGAGGACGGCATTGAGGTCAATCAGGAGATTGTGGTTATCACCACCAAAGGAGAAGCAATCTGCATGGCTATTGCATTAATGACCACAGCGGTCATCTCTACCTGCGACCATGGTATAGTAGCCAAGATCAAGAGAGTGATCATGGAGAGAGACACTTACCCTCGGAAGTGGGGTTTAGGTCCAAAGGCAAGTCAGA

Ensembl | 인체 수납 번호

ENSG00000130826

NCBI 수납 번호

NM_001363

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... DKC1(1736) , DKC1(1736)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Vahid Khoddami et al.
Proceedings of the National Academy of Sciences of the United States of America, 116(14), 6784-6789 (2019-03-16)
The breadth and importance of RNA modifications are growing rapidly as modified ribonucleotides can impact the sequence, structure, function, stability, and fate of RNAs and their interactions with other molecules. Therefore, knowing cellular RNA modifications at single-base resolution could provide
Meng Zhang et al.
Oncology reports, 40(2), 968-978 (2018-06-15)
DKC1, an X‑linked gene encoding dyskerin at Xq28, is a crucial component of the telomerase complex and is indispensable for normal telomere function and the post‑-transcriptional modification of precursor rRNA. It has been revealed to exert diverse biological functions and
Fa-An Miao et al.
Investigational new drugs, 37(6), 1177-1186 (2019-03-09)
The dyskeratosis congenita 1 (DKC1) gene is located on the X chromosome at Xq28. Dyskerin encoded by the DKC1 gene is associated with the formation of certain small RNAs and the telomerase activity. Inherited mutations in DKC1 inactivate the dyskerin
Nunzia Di Maio et al.
FEBS open bio, 7(10), 1453-1468 (2017-10-06)
Dyskerin is an essential, conserved, multifunctional protein found in the nucleolus, whose loss of function causes the rare genetic diseases X-linked dyskeratosis congenita and Hoyeraal-Hreidarsson syndrome. To further investigate the wide range of dyskerin's biological roles, we set up stable
Penelope Kroustallaki et al.
Cell reports, 28(7), 1690-1702 (2019-08-15)
Telomerase biogenesis is a complex process where several steps remain poorly understood. Single-strand-selective uracil-DNA glycosylase (SMUG1) associates with the DKC1-containing H/ACA ribonucleoprotein complex, which is essential for telomerase biogenesis. Herein, we show that SMUG1 interacts with the telomeric RNA component

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.