콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU030961

Sigma-Aldrich

MISSION® esiRNA

targeting human ERBB3

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TGGAACTGTGCACAAAGGAGTGTGGATCCCTGAGGGTGAATCAATCAAGATTCCAGTCTGCATTAAAGTCATTGAGGACAAGAGTGGACGGCAGAGTTTTCAAGCTGTGACAGATCATATGCTGGCCATTGGCAGCCTGGACCATGCCCACATTGTAAGGCTGCTGGGACTATGCCCAGGGTCATCTCTGCAGCTTGTCACTCAATATTTGCCTCTGGGTTCTCTGCTGGATCATGTGAGACAACACCGGGGGGCACTGGGGCCACAGCTGCTGCTCAACTGGGGAGTACAAATTGCCAAGGGAATGTACTACCTTGAGGAACATGGTATGGTGCATAGAAACCTGGCTGCCCGAAACGTGCTACTCAAGTCACCCAGTCAGGTTCAGGTGGCAGATTTTGGTGTGGCTGACCT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Sarah Croessmann et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 25(1), 277-289 (2018-10-14)
We examined the role of ERBB2-activating mutations in endocrine therapy resistance in estrogen receptor positive (ER+) breast cancer. ERBB2 mutation frequency was determined from large genomic databases. Isogenic knock-in ERBB2 mutations in ER+ MCF7 cells and xenografts were used to
Majid Momeny et al.
Cellular oncology (Dordrecht), 42(4), 491-504 (2019-04-27)
Pancreatic ductal adenocarcinoma (PDAC), the most common malignancy of the pancreas, is the fourth most common cause of cancer-related death in the USA. Local progression, early tumor dissemination and low efficacy of current treatments are the major reasons for its
Human Papillomavirus Regulates HER3 Expression in Head and Neck Cancer: Implications for Targeted HER3 Therapy in HPV
Toni M Brand et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 23(12), 3072-3083 (2016-12-18)
Aili Wang et al.
Aging, 12(6), 4866-4878 (2020-03-15)
Development of specific serum biomarkers is essential to improve diagnosis and prognosis of non-small cell lung cancer (NSCLC). Here, we show that serum and tissue levels of miR-519d are significantly decreased in NSCLC patients. The low expression of miR-519d is
Spencer S Watson et al.
Cell systems, 6(3), 329-342 (2018-03-20)
Extrinsic signals are implicated in breast cancer resistance to HER2-targeted tyrosine kinase inhibitors (TKIs). To examine how microenvironmental signals influence resistance, we monitored TKI-treated breast cancer cell lines grown on microenvironment microarrays composed of printed extracellular matrix proteins supplemented with

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.