설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TGGAACTGTGCACAAAGGAGTGTGGATCCCTGAGGGTGAATCAATCAAGATTCCAGTCTGCATTAAAGTCATTGAGGACAAGAGTGGACGGCAGAGTTTTCAAGCTGTGACAGATCATATGCTGGCCATTGGCAGCCTGGACCATGCCCACATTGTAAGGCTGCTGGGACTATGCCCAGGGTCATCTCTGCAGCTTGTCACTCAATATTTGCCTCTGGGTTCTCTGCTGGATCATGTGAGACAACACCGGGGGGCACTGGGGCCACAGCTGCTGCTCAACTGGGGAGTACAAATTGCCAAGGGAATGTACTACCTTGAGGAACATGGTATGGTGCATAGAAACCTGGCTGCCCGAAACGTGCTACTCAAGTCACCCAGTCAGGTTCAGGTGGCAGATTTTGGTGTGGCTGACCT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... ERBB3(2065) , ERBB3(2065)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Sarah Croessmann et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 25(1), 277-289 (2018-10-14)
We examined the role of ERBB2-activating mutations in endocrine therapy resistance in estrogen receptor positive (ER+) breast cancer. ERBB2 mutation frequency was determined from large genomic databases. Isogenic knock-in ERBB2 mutations in ER+ MCF7 cells and xenografts were used to
Majid Momeny et al.
Cellular oncology (Dordrecht), 42(4), 491-504 (2019-04-27)
Pancreatic ductal adenocarcinoma (PDAC), the most common malignancy of the pancreas, is the fourth most common cause of cancer-related death in the USA. Local progression, early tumor dissemination and low efficacy of current treatments are the major reasons for its
Human Papillomavirus Regulates HER3 Expression in Head and Neck Cancer: Implications for Targeted HER3 Therapy in HPV
Toni M Brand et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 23(12), 3072-3083 (2016-12-18)
MiR-519d targets HER3 and can be used as a potential serum biomarker for non-small cell lung cancer.
Aili Wang et al.
Aging, 12(6), 4866-4878 (2020-03-15)
Development of specific serum biomarkers is essential to improve diagnosis and prognosis of non-small cell lung cancer (NSCLC). Here, we show that serum and tissue levels of miR-519d are significantly decreased in NSCLC patients. The low expression of miR-519d is
Spencer S Watson et al.
Cell systems, 6(3), 329-342 (2018-03-20)
Extrinsic signals are implicated in breast cancer resistance to HER2-targeted tyrosine kinase inhibitors (TKIs). To examine how microenvironmental signals influence resistance, we monitored TKI-treated breast cancer cell lines grown on microenvironment microarrays composed of printed extracellular matrix proteins supplemented with
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.