콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU030221

Sigma-Aldrich

MISSION® esiRNA

targeting human SATB2

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CAACCAAGTGCCAGGAGTTTGGGAGATGGTATAAAAAGTACAAGAAGATTAAAGTGGAAAGAGTGGAACGAGAAAACCTTTCAGACTATTGTGTTCTGGGCCAGCGTCCAATGCATTTACCAAATATGAACCAGCTGGCATCCCTGGGGAAAACCAACGAACAGTCTCCTCACAGCCAAATTCACCACAGTACTCCAATCCGAAACCAAGTGCCCGCATTACAGCCCATCATGAGCCCTGGTCTTCTTTCTCCCCAGCTTAGTCCACAACTTGTAAGGCAACAAATAGCCATGGCCCATCTGATAAACCAACAGATTGCCGTTAGCCGGCTCCTGGCTCACCAGCATCCTCAAGCCATCAACCAGCAGTTCCTGAACCATCCACCCATCCCCAGAGCAGTTAAGCCAGAGCCAAC

Ensembl | 인체 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

J-Y Li et al.
European review for medical and pharmacological sciences, 23(15), 6394-6403 (2019-08-06)
We aimed to explore the role of microRNA-449b-5p in osteogenic differentiation of bone marrow mesenchymal stem cells (BMSCs) and its mechanism of action. Quantitative Real Time-Polymerase Chain Reaction (qRT-PCR) assay was used to detect the expression levels of microRNA-449b-5p and
Yi-Qing Wang et al.
Cancer research, 79(14), 3542-3556 (2019-03-13)
Accumulating evidence suggests that long noncoding RNA (lncRNA) plays important regulatory roles in cancer biology. However, the involvement of lncRNA in colorectal carcinoma progression remains largely unknown, especially in colorectal carcinoma metastasis. In this study, we investigated the changes in
Jianbing Hao et al.
Cell and tissue research, 366(3), 733-746 (2016-08-10)
Increasing evidence shows that aldosterone and specific microRNAs (miRs) contribute to vascular smooth muscle cell (VSMC) calcification. In this study, we aim to explore the mechanistic links between miR-34b/c and aldosterone in VSMC calcification. VSMC calcification models were established both
Jianfei Tang et al.
Bone, 114, 137-143 (2018-06-18)
Emerging evidence indicates that microRNAs (miRNAs, miRs) play diverse roles in the regulation of biological processes, including osteoblastic differentiation. In this study, we found that miR-383 is a critical regulator of osteoblastic differentiation. We showed that miR-383 was downregulated during

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.