설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CAACCAAGTGCCAGGAGTTTGGGAGATGGTATAAAAAGTACAAGAAGATTAAAGTGGAAAGAGTGGAACGAGAAAACCTTTCAGACTATTGTGTTCTGGGCCAGCGTCCAATGCATTTACCAAATATGAACCAGCTGGCATCCCTGGGGAAAACCAACGAACAGTCTCCTCACAGCCAAATTCACCACAGTACTCCAATCCGAAACCAAGTGCCCGCATTACAGCCCATCATGAGCCCTGGTCTTCTTTCTCCCCAGCTTAGTCCACAACTTGTAAGGCAACAAATAGCCATGGCCCATCTGATAAACCAACAGATTGCCGTTAGCCGGCTCCTGGCTCACCAGCATCCTCAAGCCATCAACCAGCAGTTCCTGAACCATCCACCCATCCCCAGAGCAGTTAAGCCAGAGCCAAC
Ensembl | 인체 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... SATB2(23314) , SATB2(23314)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
J-Y Li et al.
European review for medical and pharmacological sciences, 23(15), 6394-6403 (2019-08-06)
We aimed to explore the role of microRNA-449b-5p in osteogenic differentiation of bone marrow mesenchymal stem cells (BMSCs) and its mechanism of action. Quantitative Real Time-Polymerase Chain Reaction (qRT-PCR) assay was used to detect the expression levels of microRNA-449b-5p and
Yi-Qing Wang et al.
Cancer research, 79(14), 3542-3556 (2019-03-13)
Accumulating evidence suggests that long noncoding RNA (lncRNA) plays important regulatory roles in cancer biology. However, the involvement of lncRNA in colorectal carcinoma progression remains largely unknown, especially in colorectal carcinoma metastasis. In this study, we investigated the changes in
Jianbing Hao et al.
Cell and tissue research, 366(3), 733-746 (2016-08-10)
Increasing evidence shows that aldosterone and specific microRNAs (miRs) contribute to vascular smooth muscle cell (VSMC) calcification. In this study, we aim to explore the mechanistic links between miR-34b/c and aldosterone in VSMC calcification. VSMC calcification models were established both
Jianfei Tang et al.
Bone, 114, 137-143 (2018-06-18)
Emerging evidence indicates that microRNAs (miRNAs, miRs) play diverse roles in the regulation of biological processes, including osteoblastic differentiation. In this study, we found that miR-383 is a critical regulator of osteoblastic differentiation. We showed that miR-383 was downregulated during
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.