설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CAGGAGTCCTTGGCTTTGAACTCACACATTACAGGACATATCACAGGCATGGCTAGTGCCTTCAGGACGGTATATCAAGTAGGTGGGGTGACCGCCTATTTCCGAGGGGTGCAGGCCAGAGTAATTTACCAGATCCCCTCCACAGCCATCGCATGGTCTGTGTATGAGTTCTTCAAATACCTAATCACTAAAAGGCAAGAAGAGTGGAGGGCTGGCAAGTGAAGTAGCACTGAACGAAGCCAGGGGTTCAGATGACACTGCTGCATCCTGGTCACATTCTCTGTCTCCTGGAATGCTCCCACCTCAAGTGGAGTTAGAAGGAAGGTAGAGGGGCTCTCCCCCAGGATTTTGGTGTTTTGACTAACACCAGTTCCTGCCAACCTCTGTTGCCACCACCTTTCCTTCCAGGCCCTAAG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... SLC25A28(81894) , SLC25A28(81894)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Changfeng Li et al.
Developmental cell, 46(4), 441-455 (2018-08-14)
Pancreatic cancer is an aggressive malignancy with changes in the tumor microenvironment. Here, we demonstrate that PINK1 and PARK2 suppressed pancreatic tumorigenesis through control of mitochondrial iron-dependent immunometabolism. Using mouse models of spontaneous pancreatic cancer, we show that depletion of Pink1 and Park2
Chunlei Wang et al.
European journal of medical research, 19, 49-49 (2014-09-27)
Among glioma treatment strategies, arsenic trioxide (As2O3) has shown efficacy as a therapeutic agent against human gliomas. However, the exact antitumor mechanism of action of As2O3 is still unclear. Mitochondria are considered to be the major source of intracellular reactive
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.