콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU029261

Sigma-Aldrich

MISSION® esiRNA

targeting human FANCD2

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TCCGACTTGACCCAAACTTCCTATTGAAGGTTCGCCAGTTGGTGATGGATAAGTTGTCGTCTATTAGATTGGAGGATTTACCTGTGATAATAAAGTTCATTCTTCATTCCGTAACAGCCATGGATACACTTGAGGTAATTTCTGAGCTTCGGGAGAAGTTGGATCTGCAGCATTGTGTTTTGCCATCACGGTTACAGGCTTCCCAAGTAAAGTTGAAAAGTAAAGGACGAGCAAGTTCCTCAGGAAATCAAGAAAGCAGCGGTCAGAGCTGTATTATTCTCCTCTTTGATGTAATAAAGTCAGCTATTAGATATGAGAAAACCATTTCAGAAGCCTGGATTAAGGCAATTGAAAACACTGCCTCAGTATCTGAACACAAGGTGTTTGACCTGGTGATGCTTTTCATCATCTATAGCACCAATACTCAGACAAAGAAGTACATTGACAGGGTGCTAAGAAATAAGATTCGATCAGGCTGCATT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jian Chen et al.
Hepatology (Baltimore, Md.), 65(2), 678-693 (2017-01-24)
Exposure to genotoxins such as ethanol-derived acetaldehyde leads to DNA damage and liver injury and promotes the development of cancer. We report here a major role for the transforming growth factor β/mothers against decapentaplegic homolog 3 adaptor β2-Spectrin (β2SP, gene
Anaid Benitez et al.
Molecular cell, 71(4), 621-628 (2018-07-31)
FANCA is a component of the Fanconi anemia (FA) core complex that activates DNA interstrand crosslink repair by monoubiquitination of FANCD2. Here, we report that purified FANCA protein catalyzes bidirectional single-strand annealing (SA) and strand exchange (SE) at a level
Min Peng et al.
The EMBO journal, 33(15), 1698-1712 (2014-06-27)
Several proteins in the BRCA-Fanconi anemia (FA) pathway, such as FANCJ, BRCA1, and FANCD2, interact with mismatch repair (MMR) pathway factors, but the significance of this link remains unknown. Unlike the BRCA-FA pathway, the MMR pathway is not essential for

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.