콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU028441

Sigma-Aldrich

MISSION® esiRNA

targeting human STIM2

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TCCCTGCATGTCACTGAGTCCACCATGCTTTACAGAAGAAGACAGATTTAGTCTGGAAGCTCTTCAAACAATACATAAACAAATGGATGATGACAAAGATGGTGGAATTGAAGTAGAGGAAAGTGATGAATTCATCAGAGAAGATATGAAATATAAAGATGCTACTAATAAACACAGCCATCTGCACAGAGAAGATAAACATATAACGATTGAGGATTTATGGAAACGATGGAAAACATCAGAAGTTCATAATTGGACCCTTGAAGACACTCTTCAGTGGTTGATAGAGTTTGTTGAACTACCCCAATATGAGAAGAATTTTAGAGACAACAATGTCAAAGGAACGACACTTCCCAGGATAGCAGTGCACGAACCTTCATTTATGATCTCCCAGTTGAAAATCAGTGACCGGAGTCACAGACAAAAACTTCAGCTCAAGGCATTGGATGTGGTTTTGTTTGGACCTCTAACACGCCCACCTCAT

Ensembl | 인체 수납 번호

ENSG00000109689

NCBI 수납 번호

NM_020860

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... STIM2(57620) , STIM2(57620)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jiwang Chen et al.
Circulation, 135(16), 1532-1546 (2017-02-17)
Pulmonary arterial hypertension is a severe and progressive disease, a hallmark of which is pulmonary vascular remodeling. Nicotinamide phosphoribosyltransferase (NAMPT) is a cytozyme that regulates intracellular nicotinamide adenine dinucleotide levels and cellular redox state, regulates histone deacetylases, promotes cell proliferation
Vladimir A Vigont et al.
Frontiers in cell and developmental biology, 9, 625231-625231 (2021-02-20)
Huntington's disease (HD) is a severe autosomal-dominant neurodegenerative disorder caused by a mutation within a gene, encoding huntingtin protein. Here we have used the induced pluripotent stem cell technology to produce patient-specific terminally differentiated GABA-ergic medium spiny neurons modeling a
Raz Palty et al.
Cell research, 25(8), 963-980 (2015-07-04)
Calcium flux through store-operated calcium entry is a major regulator of intracellular calcium homeostasis and various calcium signaling pathways. Two key components of the store-operated calcium release-activated calcium channel are the Ca(2+)-sensing protein stromal interaction molecule 1 (STIM1) and the
Ruby A Fernandez et al.
American journal of physiology. Cell physiology, 308(8), C581-C593 (2015-02-13)
Pulmonary arterial hypertension (PAH) is a progressive disease that, if left untreated, eventually leads to right heart failure and death. Elevated pulmonary arterial pressure (PAP) in patients with PAH is mainly caused by an increase in pulmonary vascular resistance (PVR).
Jingsheng Xia et al.
The Journal of physiology, 592(16), 3443-3461 (2014-05-27)
Store-operated calcium channels (SOCs) are calcium-selective cation channels that mediate calcium entry in many different cell types. Store-operated calcium entry (SOCE) is involved in various cellular functions. Increasing evidence suggests that impairment of SOCE is responsible for numerous disorders. A

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.