콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU027651

Sigma-Aldrich

MISSION® esiRNA

targeting human SQSTM1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

AGAACGTTGGGGAGAGTGTGGCAGCTGCCCTTAGCCCTCTGGGCATTGAAGTTGATATCGATGTGGAGCACGGAGGGAAAAGAAGCCGCCTGACCCCCGTCTCTCCAGAGAGTTCCAGCACAGAGGAGAAGAGCAGCTCACAGCCAAGCAGCTGCTGCTCTGACCCCAGCAAGCCGGGTGGGAATGTTGAGGGCGCCACGCAGTCTCTGGCGGAGCAGATGAGGAAGATCGCCTTGGAGTCCGAGGGGCGCCCTGAGGCAATGGAGTCGGATAACTGTTCAGGAGGAGATGATGACTGGACCCATCTGTCTTCAAAAGAAGTGGACCCGTCTACAGGTGAACTCCAGTCCCTACAGATGCCAGAATCCGAAGGGCCAAGCTCTCTGGACCCCTCCCAGGAGGGACCCACAGGGCTGAAGGAAGCTGCCTTGTACCCACATCTCCCGCCAGCTGACCCGCGGCTGATTGAGTCCCTCTCCCAGATG

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Akihito Arai et al.
American journal of cancer research, 7(4), 881-891 (2017-05-05)
Hypopharyngeal carcinoma is one of the worst prognostic malignancies among head and neck carcinomas. Therefore, a good biomarker should be identified to predict the best therapeutic option before starting the treatment. In cell models, p62/SQSTM1 levels affected the Nrf2-Keap1 pathway
Tania M Puvirajesinghe et al.
Nature communications, 7, 10318-10318 (2016-01-13)
The non-canonical Wnt/planar cell polarity (Wnt/PCP) pathway plays a crucial role in embryonic development. Recent work has linked defects of this pathway to breast cancer aggressiveness and proposed Wnt/PCP signalling as a therapeutic target. Here we show that the archetypal
Prasun Guha et al.
Oncotarget, 8(40), 68191-68207 (2017-10-06)
Studies suggest that tunicamycin may work as a therapeutic drug to cancer cells by inducing stress in the endoplasmic reticulum (ER) through unfolded protein response (UPR) and thereby promoting apoptosis. However, mechanisms of the prolonged activation of the UPR under
Haofeng Ning et al.
Experimental and therapeutic medicine, 14(6), 5417-5423 (2017-12-30)
Macrophage autophagy has a protective role in the development of atherosclerosis; however, it turns dysfunctional in advanced lesions with an increase in p62/sequestosome-1 protein. Little is known about the role and significance of p62 accumulation in atherosclerosis. The present study
Arishya Sharma et al.
Autophagy, 14(11), 1976-1990 (2018-07-12)
Recent reports have made important revelations, uncovering direct regulation of DNA damage response (DDR)-associated proteins and chromatin ubiquitination (Ubn) by macroautophagy/autophagy. Here, we report a previously unexplored connection between autophagy and DDR, via a deubiquitnase (DUB), USP14. Loss of autophagy

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.