설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GCCCAATCACAAGTCAGGTTCCTATCCCACCCCTTCACCATGCCATGAAAATTTTGTAGTGGGGGCAAATAGGGCTTCACATAGGGCAGCAGCACCACCTCGACTTCTGCCCCCATTGCCCACTTGCTATGGGCCTCTCAAAGTGGGAGGCACAAACCCCAGCTGTGGTCATCCTGAGGTGGGCAGGCTAGGAGGGGGTCCTGCCTTGTACCCTCCTCCCGAAGGACAGGTATGTAACCCCCTGGACTCTCTTGATCTTGACAACACTCAGCTGGACTTTGTGGCTATTCTGGATGAGCCCCAGGGGCTGAGTCCTCCTCCTTCCCATGATCAGCGGGGCAGCTCTGGACATACCCCACCTCCCTCTGGGCCCCCCAACATGGCTGTGGGCAACATGAGTGTCTTACTGAGATCCCTACCTGGGGAAACAGAATTCCTCAACTCTAGTGCCTAAAGAGTAGGGAATCTCATCCATCACAGATCGCAT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... GLI1(2735) , GLI1(2735)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Yang Chong et al.
Journal of experimental & clinical cancer research : CR, 35(1), 175-175 (2016-11-12)
Gastric cancer (GC) is characterized by the excessive deposition of extracellular matrix, which is thought to contribute to this tumor's malignant behavior. Epithelial-mesenchymal transition (EMT) is regarded as a crucial contributing factor to cancer progression. Galectin-1 (Gal-1), a β-galactoside-binding protein
Xinyi Cai et al.
OncoTargets and therapy, 8, 877-883 (2015-05-07)
The Hedgehog (Hh) signaling pathway not only plays important roles in embryogenesis and adult tissue homeostasis, but also in tumorigenesis. Aberrant Hh pathway activation has been reported in a variety of malignant tumors including colon carcinoma. Here, we sought to
Hyungsin Kim et al.
Cancers, 11(9) (2019-09-08)
Despite the presence of aggressive treatment strategies, glioblastoma remains intractable, warranting a novel therapeutic modality. An oral antipsychotic agent, penflurido (PFD), used for schizophrenia treatment, has shown an antitumor effect on various types of cancer cells. As glioma sphere-forming cells
Yumei Diao et al.
Molecular oncology, 12(10), 1718-1734 (2018-08-12)
Hedgehog (HH) signaling is involved in many physiological processes, and pathway deregulation can result in a wide range of malignancies. Glioma-associated oncogene 1 (GLI1) is a transcription factor and a terminal effector of the HH cascade. Despite its crucial role
Guodong Zhang et al.
Experimental and therapeutic medicine, 19(4), 2913-2922 (2020-04-08)
The efficacy of ginsenoside Rh2 (Rh2) in cancer therapy has been reported; however, its function in lung cancer remains unknown. To analyze the role of Rh2 in the inhibition of lung cancer cell proliferation in the present study, protein expression
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.