콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU024131

Sigma-Aldrich

MISSION® esiRNA

targeting human KCNN1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TTCAGCATCTCCTCCTGGATCATCGCAGCCTGGACCGTGCGCGTCTGCGAGAGGTACCACGACAAGCAGGAAGTGACCAGCAACTTCCTGGGGGCCATGTGGCTGATTTCCATCACCTTCCTCTCCATTGGCTACGGCGACATGGTGCCCCACACCTACTGCGGGAAGGGTGTGTGCCTGCTCACTGGCATCATGGGAGCTGGCTGTACCGCGCTCGTGGTGGCTGTGGTGGCTCGGAAGCTGGAGCTCACCAAGGCTGAGAAGCACGTGCACAACTTCATGATGGACACTCAGCTCACCAAGCGGGTAAAAAACGCCGCTGCTAACGTTCTCAGGGAGACGTGGCTCATCTACAAACATACCAGGCTGGTGAAGAAGCCAGACCAAGCCCGGGTTCGGAAACACCAGCGTAAGTTCCTCCAAGCCATCCATCATGGCAGGATGCTCCGGAGTGTGAAGATCGAGCAAGGGAAGCTGAACGACCAGGCTAA

Ensembl | 인체 수납 번호

ENSG00000105642

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... KCNN1(3780) , KCNN1(3780)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

죄송합니다. 지금은 이 제품에 대한 COA이(가) 온라인에서 제공되지 않습니다.

도움이 필요하시면 연락하세요. 고객 지원 부서

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Young-Jin Seo et al.
PloS one, 8(8), e75005-e75005 (2013-10-19)
Influenza continues to pose a threat to humans by causing significant morbidity and mortality. Thus, it is imperative to investigate mechanisms by which influenza virus manipulates the function of host factors and cellular signal pathways. In this study, we demonstrate
Heba Alshaker et al.
Frontiers in pharmacology, 10, 303-303 (2019-04-12)
Sphingosine kinases 1 and 2 (SK1 and SK2) are proto-oncogenic isozymes expressed in many human tumors and associated with chemoresistance and poor prognosis. They are well-recognized therapy targets and their inhibition was shown to induce tumor volume reduction and chemosensitization
Ilari Pulli et al.
Biochimica et biophysica acta, 1853(9), 2173-2182 (2015-04-22)
Caveolae are plasma membrane invaginations enriched in sterols and sphingolipids. Sphingosine kinase 1 (SK1) is an oncogenic protein that converts sphingosine to sphingosine 1-phosphate (S1P), which is a messenger molecule involved in calcium signaling. Caveolae contain calcium responsive proteins, but

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.