콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU021911

Sigma-Aldrich

MISSION® esiRNA

targeting human UCHL1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CTGTGGCACAATCGGACTTATTCACGCAGTGGCCAATAATCAAGACAAACTGGGATTTGAGGATGGATCAGTTCTGAAACAGTTTCTTTCTGAAACAGAGAAAATGTCCCCTGAAGACAGAGCAAAATGCTTTGAAAAGAATGAGGCCATACAGGCAGCCCATGATGCCGTGGCACAGGAAGGCCAATGTCGGGTAGATGACAAGGTGAATTTCCATTTTATTCTGTTTAACAACGTGGATGGCCACCTCTATGAACTTGATGGACGAATGCCTTTTCCGGTGAACCATGGCGCCAGTTCAGAGGACACCCTGCTGAAGGACGCTGCCAAGGTCTGCAGAGAATTCACCGAGCGTGAGCAAGGAGAAGTCCGCTTCTCTGCCGTGGCTCTCTGCAAGGCAGCCTAATGCTCTGTGGGAGGGAC

Ensembl | 인체 수납 번호

ENSG00000154277

NCBI 수납 번호

NM_004181

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... UCHL1(7345) , UCHL1(7345)

관련 카테고리

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yuyin Xu et al.
Experimental cell research, 382(2), 111463-111463 (2019-06-28)
Diabetic nephrology (DN) is attributed largely to the depletion of podocytes, which is closely associated to apoptosis. However, the complex mechanism of podocyte loss in DN pathogenesis remains unclear. Recently, necroptosis has emerged as an important cell death model in
Yanhong Luo et al.
Journal of cellular biochemistry, 119(1), 691-700 (2017-06-22)
As a de-ubiquitin enzyme, ubiquitin C-terminal hydrolase (UCH)-L1 has been shown to be overexpressed in several human cancers. However, the function of UCH-L1 in invasion of breast cancers is still unclear. Here we report that the expression of UCH-L1 is
Wenjuan Wang et al.
Molecular carcinogenesis, 55(9), 1329-1342 (2015-08-22)
Multidrug resistant (MDR) cancer cells overexpressing P-glycoprotein (P-gp) exhibit enhanced invasive/metastatic ability as compared with the sensitive cells. We aimed to clarify the mechanism underlying this observation and found that during the development of drug resistance to adriamycin in MCF7
Eun Young Seo et al.
The Journal of investigative dermatology, 137(8), 1757-1765 (2017-04-11)
Ubiquitin carboxyl-terminal hydrolase L1 (UCHL1) is involved in many signaling pathways via the ubiquitin-proteasome system. UCHL1 is expressed in the human skin and serves as a neuronal marker; however, its functions in melanogenesis remain unknown. Here, we investigated the role
Hongbo Gao et al.
Biochemical and biophysical research communications, 492(1), 96-102 (2017-08-15)
Skeletal muscles are dynamic tissues that possess regenerative abilities, which require multiple processes and regulatory factors. Ubiquitin C-Terminal Hydrolase L1 (UCHL1), which is primarily expressed in neuronal tissues, was upregulated in skeletal muscles in disease conditions but its functional role
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.