콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU020361

Sigma-Aldrich

MISSION® esiRNA

targeting human CUL4A

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TGCTTGTGTGGAGAAACAGCTATTAGGAGAACATTTAACAGCAATTCTGCAGAAAGGGCTCGACCACTTACTGGATGAGAACAGAGTGCCGGACCTCGCACAGATGTACCAGCTGTTCAGCCGGGTGAGGGGCGGGCAGCAGGCGCTGCTGCAGCACTGGAGCGAGTACATCAAGACTTTTGGAACAGCGATCGTAATCAATCCTGAGAAAGACAAAGACATGGTCCAAGACCTGTTGGACTTCAAGGACAAGGTGGACCACGTGATCGAGGTCTGCTTCCAGAAGAATGAGCGGTTCGTCAACCTGATGAAGGAGTCCTTTGAGACGTTCATCAACAAGAGACCCAACAAGCCTGCAGAACTGATCGCAAAGCATGTGGATTCAAAGTTAAGAGCAGGCAACAAAGAAGCCACAGACGAGGA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yidan Ren et al.
Respiratory research, 20(1), 84-84 (2019-05-08)
Chronic obstructive pulmonary disease (COPD) is a common respiratory disease with high morbidity and mortality. The most important pathophysiological change of COPD is airway obstruction. Airway obstruction can cause airflow restriction and obstructive ventilation dysfunction. Currently, many studies have shown
B Englinger et al.
British journal of cancer, 116(4), 489-500 (2017-01-18)
Colorectal carcinoma (CRC) is the third most common cancer worldwide. Platinum-based anticancer compounds still constitute one mainstay of systemic CRC treatment despite limitations due to adverse effects and resistance development. Trabectedin has shown promising antitumor effects in CRC, however, again
Laura P Saucedo-Cuevas et al.
Oncotarget, 5(8), 2330-2343 (2014-05-30)
The CUL4A E3 ubiquitin ligase is involved in the regulation of many cellular processes and its amplification and/or overexpression has been observed in breast cancer. The 13q34 amplification, which is associated with the basal-like breast cancer subtype, has been proposed

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.