콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

모든 문서 보기

EHU020331

Sigma-Aldrich

MISSION® esiRNA

targeting human IRS1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GACCCCAATGGCTACATGATGATGTCCCCCAGCGGTGGCTGCTCTCCTGACATTGGAGGTGGCCCCAGCAGCAGCAGCAGCAGCAGCAACGCCGTCCCTTCCGGGACCAGCTATGGAAAGCTGTGGACAAACGGGGTAGGGGGCCACCACTCTCATGTCTTGCCTCACCCCAAACCCCCAGTGGAGAGCAGCGGTGGTAAGCTCTTACCTTGCACAGGTGACTACATGAACATGTCACCAGTGGGGGACTCCAACACCAGCAGCCCCTCCGACTGCTACTACGGCCCTGAGGACCCCCAGCACAAGCCAGTCCTCTCCTACTACTCATTGCCAAGATCCTTTAAGCACACCCAGCGCCCCGGGGAGCCGGAGGAGGGTGCCCGGCATCAGCACCTCCGCCTTTCCACTAGCTCTGGTCGCCTTC

Ensembl | 인체 수납 번호

ENSG00000169047

NCBI 수납 번호

NM_005544

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... IRS1(3667) , IRS1(3667)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
ZCV
EZU
QAS
DOR

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yongxin Luan et al.
International journal of clinical and experimental pathology, 8(9), 10345-10354 (2015-12-01)
MicroRNA (miR-126) was reported to be downregulated and to act as a tumor suppressor in cancers of the lung, cervix, bladder, breast, liver and prostate. However, the precise roles and underling mechanisms of miR-126 in glioma remain largely unknown. This
Y Chen et al.
European review for medical and pharmacological sciences, 23(18), 7989-7999 (2019-10-11)
The important role of microRNA-1271 (miR-1271) has been identified in human diseases and cancers. However, the biological function of miR-1271 remains ambiguous in papillary thyroid carcinoma (PTC). Therefore, the specific role of miR-1271 was investigated in PTC. The expressions of
Peng Wang et al.
Technology in cancer research & treatment, 16(6), 1102-1112 (2018-01-16)
Thyroid cancer is a common endocrine gland malignancy which exhibited rapid increased incidence worldwide in recent decades. This study was aimed to investigate the role of long noncoding RNA H19 in thyroid cancer. Long noncoding RNA H19 was overexpressed or
Qianyi Luo et al.
Investigative ophthalmology & visual science, 60(6), 1928-1936 (2019-05-03)
Diabetes leads to the downregulation of the retinal Kir4.1 channels and Müller cell dysfunction. The insulin receptor substrate-1 (IRS-1) is a critical regulator of insulin signaling in Müller cells. Circadian rhythms play an integral role in normal physiology; however, diabetes
Piero Dalle Pezze et al.
Nature communications, 7, 13254-13254 (2016-11-22)
Amino acids (aa) are not only building blocks for proteins, but also signalling molecules, with the mammalian target of rapamycin complex 1 (mTORC1) acting as a key mediator. However, little is known about whether aa, independently of mTORC1, activate other
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.