콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU020151

Sigma-Aldrich

MISSION® esiRNA

targeting human ADAM9

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

AGGCGGGATTAATGTGTTTGGACAAATCACTGTGGAGACATTTGCTTCCATTGTTGCTCATGAATTGGGTCATAATCTTGGAATGAATCACGATGATGGGAGAGATTGTTCCTGTGGAGCAAAGAGCTGCATCATGAATTCAGGAGCATCGGGTTCCAGAAACTTTAGCAGTTGCAGTGCAGAGGACTTTGAGAAGTTAACTTTAAATAAAGGAGGAAACTGCCTTCTTAATATTCCAAAGCCTGATGAAGCCTATAGTGCTCCCTCCTGTGGTAATAAGTTGGTGGACGCTGGGGAAGAGTGTGACTGTGGTACTCCAAAGGAATGTGAATTGGACCCTTGCTGCGAAGGAAGTACCTGTAAGCTTAAATCATTTGCTGAGTGTGCATATGGTGACTGTTGTAAAGACTGTCGGTTCCTTCCA

Ensembl | 인체 수납 번호

ENSG00000168615

NCBI 수납 번호

NM_003816

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... ADAM9(8754) , ADAM9(8754)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Rui Zhou et al.
Frontiers in medicine, 7, 214-214 (2020-07-09)
Upregulation of a disintegrin and metalloprotease 9 (ADAM9) is correlated with progression of cancers, such as prostate, bladder, and pancreatic cancers. However, its role in triple-negative breast cancer (TNBC) is still unclear. Our study aimed to investigate whether ADAM9 is
Jun Arai et al.
Journal of gastroenterology and hepatology, 33(5), 1075-1081 (2017-10-22)
The multi-kinase inhibitor regorafenib (REG) was recently demonstrated to be effective in patients with sorafenib (SOR)-resistant hepatocellular carcinoma (HCC). Interestingly, SOR is known to enhance the accumulation of membrane-bound MHC class I polypeptide-related sequence A (mMICA) in HCC cells and
Mari Ueno et al.
Cancer science, 109(2), 471-482 (2017-12-17)
ADAMs (a disintegrin and metalloproteinases) are involved in various biological events such as cell adhesion, migration and invasion, membrane protein shedding and proteolysis. However, there have been no systematic studies on the expression of ADAMs in human ovarian carcinomas. We
Liang Chang et al.
Molecular medicine reports, 12(1), 1197-1204 (2015-03-18)
A disintegrin and metalloproteinase 9 (ADAM9) is a type I transmembrane protein that has been associated with cancer development and metastasis in various types of cancer. However, little is known about its role in non-small cell lung cancer (NSCLC). The
Kenzo Sonoda et al.
BioMed research international, 2014, 482396-482396 (2014-09-02)
In several human malignancies, the expression of receptor-binding cancer antigen expressed on SiSo cells (RCAS1) is associated with aggressive characteristics and poor overall survival. RCAS1 alters the tumor microenvironment by inducing peripheral lymphocyte apoptosis and angiogenesis, while reducing the vimentin-positive

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.