콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

View All Documentation

EHU019041

Sigma-Aldrich

MISSION® esiRNA

targeting human STK11

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GAGGAGGTTACGGCACAAAAATGTCATCCAGCTGGTGGATGTGTTATACAACGAAGAGAAGCAGAAAATATATCCTTTCCGCCCTTACTGCGTGTGTGGCATGCAGGAAATGCTGGACAGCGTGCCGGAGAAGCGTTTCCCAGTGTGCCAGGCCCACGGGTACTTCTGTCAGCTGATTGACGGCCTGGAGTACCTGCATAGCCAGGGCATTGTGCACAAGGACATCAAGCCGGGGAACCTGCTGCTCACCACCGGTGGCACCCTCAAAATCTCCGACCTGGGCGTGGCCGAGGCACTGCACCCGTTCGCGGCGGACGACACCTGCCGGACCAGCCAGGGCTCCCCGGCTTTCCAGCCGCCCGAGATTGCCAACGGCCTGGACACCTTCTCCGGCTTCAAGGTGGACATCTGGTCGGCTGGGGTCACCCTCTACAACATCACCACGGGTCTGTACCCCTTCGAAGGGGACAACATCTACAAGTTGTTTGAGAACATCGGGAAGG

Ensembl | 인체 수납 번호

ENSG00000118046

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... STK11(6794) , STK11(6794)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Qing Ma et al.
Oncology letters, 16(1), 1291-1297 (2018-07-03)
Liver kinase B1 (LKB1) encodes a serine/threonine kinase and functions as a tumor suppressor. LKB1 loss-of-function somatic mutations are frequently observed in sporadic types of cancer, particularly in lung cancer. Ectopic LKB1 induces growth arrest by upregulating p21/cyclin dependent kinase
Taiyuan Li et al.
Biochemical and biophysical research communications, 482(4), 1037-1041 (2016-12-03)
Partitioning defective 3-like protein (Par3L) is a recently identified cell polarity protein that plays an important role in mammary stem cell maintenance. Previously, we showed that high expression of Par3L is associated with poor survival in malignant colorectal cancer (CRC)
Youn Ju Lee et al.
PloS one, 14(1), e0211415-e0211415 (2019-01-30)
Alcoholic liver disease (ALD) is a worldwide health problem and hepatocyte apoptosis has been associated with the development/progression of ALD. However, no definite effective pharmacotherapy for ALD is currently available. Cilostazol, a selective type III phosphodiesterase inhibitor has been shown
Shalini V Rao et al.
BMC cancer, 17(1), 68-68 (2017-01-23)
The peptide hormone gastrin exerts a growth-promoting effect in both normal and malignant gastrointestinal tissue. Gastrin mediates its effect via the cholecystokinin 2 receptor (CCKBR/CCK2R). Although a substantial part of the gastric adenocarcinomas express gastrin and CCKBR, the role of
Jacob M Kaufman et al.
Cancer research, 77(1), 153-163 (2016-11-09)
LKB1 is a commonly mutated tumor suppressor in non-small cell lung cancer that exerts complex effects on signal transduction and transcriptional regulation. To better understand the downstream impact of loss of functional LKB1, we developed a transcriptional fingerprint assay representing
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.