콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

View All Documentation

EHU018231

Sigma-Aldrich

MISSION® esiRNA

targeting human SP1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CCGCTCCCAACTTACAGAACCAGCAAGTTCTGACAGGACTACCTGGAGTGATGCCTAATATTCAGTATCAAGTAATCCCACAGTTCCAGACCGTTGATGGGCAACAGCTGCAGTTTGCTGCCACTGGGGCCCAAGTGCAGCAGGATGGTTCTGGTCAAATACAGATCATACCAGGTGCAAACCAACAGATTATCACAAATCGAGGAAGTGGAGGCAACATCATTGCTGCTATGCCAAACCTACTCCAGCAGGCTGTCCCCCTCCAAGGCCTGGCTAATAATGTACTCTCAGGACAGACTCAGTATGTGACCAATGTACCAGTGGCCCTGAATGGGAACATCACCTTGCTACCTGTCAACAGCGTTTCTGCAGCTACCTTGACTCCCAGCTCTCAGGCAGTCACGATCAGCAGCTCTGGGTCCCAGGAGAGTGGCTCACAGCCTGTCACCTCAGGGACTACCATCAGTTCTGCCAGCTTGGTATCATCACAAGCCAGTTCCAGCT

Ensembl | 인체 수납 번호

ENSG00000185591

NCBI 수납 번호

NM_138473

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... SP1(6667) , SP1(6667)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Im-Kyung Kim et al.
Scientific reports, 9(1), 5933-5933 (2019-04-13)
Specific protein 1 (SP1) is associated with aggressive behavior, invasive clinical phenotype and poor clinical outcomes in various cancers. We studied whether SP1 exerts its effect on invasiveness and promotion of the epithelial-mesenchymal transition (EMT) by regulating lysyl oxidase-like 2
Qiang Cai et al.
American journal of translational research, 8(10), 4068-4081 (2016-11-11)
Gallbladder cancer (GBC) is one of the most lethal cancers with poor prognosis. In this study, we report that the long non-coding RNA LINC00152 is significantly upregulated in GBC tissues and cell lines. The high LINC00152 levels correlated positively with
Moon-Chang Choi et al.
International journal of molecular sciences, 19(5) (2018-05-12)
Osteoarthritis (OA) is the most common and increasing joint disease worldwide. Current treatment for OA is limited to control of symptoms. The purpose of this study was to determine the effect of specificity protein 1 (SP1) inhibitor Mithramycin A (MitA)
Yuehua Zhao et al.
Molecular medicine reports, 16(2), 2191-2198 (2017-06-20)
Research into the expression and function of microRNAs (miRNAs/miR) in human cancer has provided novel insights into the molecular mechanisms underlying carcinogenesis and cancer progression. Aberrant miRNA expression has been reported in retinoblastoma (RB) and several other types of human
Jingnan Liu et al.
Human molecular genetics, 25(4), 672-680 (2016-01-09)
Mutations in leucine-rich repeat kinase 2 (LRRK2) cause autosomal-dominant Parkinsonism with pleomorphic pathology including deposits of aggregated protein and neuronal degeneration. The pathogenesis of LRRK2-linked Parkinson's disease (PD) is not fully understood. Here, using co-immunoprecipitation, we found that LRRK2 interacted
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.