설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ACTGCAGAAATGAGGCTGGTTTATCTGCTGATCCGTATGTTTACAACTGGACAGCATGGTCAGAGGACAGTGACGGGGAAAATGGCACCGGCCAAAGCCATCATAACGTCTTCCCTGATGGGAAACCTTTTCCTCACCACCCCGGATGGAGAAGATGGAATTTCATCTACGTCTTCCACACACTTGGTCAGTATTTCCAGAAATTGGGACGATGTTCAGTGAGAGTTTCTGTGAACACAGCCAATGTGACACTTGGGCCTCAACTCATGGAAGTGACTGTCTACAGAAGACATGGACGGGCATATGTTCCCATCGCACAAGTGAAAGATGTGTACGTGGTAACAGATCAGATTCCTGTGTTTGTGACTATGTTCCAGAAGAACGATCGAAATTCATCCGACGAAACCTTCCTCAAAGATCTCCCC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... GPNMB(10457) , GPNMB(10457)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Rui Jin et al.
Oncology reports, 39(6), 3034-3040 (2018-04-06)
Glycoprotein non‑metastatic melanoma protein B (GPNMB) is a glycoprotein that is highly expressed in various types of cancer, including osteosarcoma. However, its cellular functions and related mechanisms in osteosarcoma remain unclear. In the present study, a higher GPNMB mRNA level was
Feifei Ren et al.
Journal of cellular physiology, 235(3), 2738-2752 (2019-09-10)
Gastric cancer has the fifth highest incidence of disease and is the third leading cause of cancer-associated mortality in the world. The etiology of gastric cancer is complex and needs to be fully elucidated. Thus, it is necessary to explore
Basilio Smuczek et al.
Experimental cell research, 358(2), 323-334 (2017-07-10)
Breast cancer is an important public health problem, and its progression may be related to the extracellular matrix (ECM), which acts as a structural scaffold and instruction source for neoplastic cells. Laminins are ECM proteins regulating tumor biology. The laminin-derived
Kotaro Kumagai et al.
PloS one, 10(11), e0143413-e0143413 (2015-11-26)
Glycoprotein nonmetastatic melanoma B (Gpnmb), a transmembrane glycoprotein that is expressed in macrophages, negatively regulates inflammation. We have reported that Gpnmb is strongly expressed in the livers of rats fed a choline-deficient, L-amino acid-defined (CDAA) diet. However, the role of
Yu-Liang Wang et al.
International journal of clinical and experimental pathology, 8(6), 6498-6504 (2015-08-12)
Glycoprotein (transmembrane) nonmetastatic melanoma protein b (GPNMB) plays crucial roles in odontogenesis. However, the role of GPNMB in human dental pulp cells (hDPCs) is still unclear. Therefore, in this study, we investigated the expression and function of the GPNMB in
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.