콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU016451

Sigma-Aldrich

MISSION® esiRNA

targeting human PTPN1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TATCCGACATGAAGCCAGTGACTTCCCATGTAGAGTGGCCAAGCTTCCTAAGAACAAAAACCGAAATAGGTACAGAGACGTCAGTCCCTTTGACCATAGTCGGATTAAACTACATCAAGAAGATAATGACTATATCAACGCTAGTTTGATAAAAATGGAAGAAGCCCAAAGGAGTTACATTCTTACCCAGGGCCCTTTGCCTAACACATGCGGTCACTTTTGGGAGATGGTGTGGGAGCAGAAAAGCAGGGGTGTCGTCATGCTCAACAGAGTGATGGAGAAAGGTTCGTTAAAATGCGCACAATACTGGCCACAAAAAGAAGAAAAAGAGATGATCTTTGAAGACACAAATTTGAAATTAACATTGATCTCTGAAGATATCAAGTCATATTATACAGTGCGACAGCTAGAATTGGAAAACCTTACAACCCAAGAAACTCGAGAGATCTTACATTTCCACTATACCACATGGCCTGACTTTGGAGTCCCTGAATCACCAGCCTCATT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Akarawin Hongdusit et al.
Nature communications, 11(1), 788-788 (2020-02-09)
Protein tyrosine phosphatases regulate a myriad of essential subcellular signaling events, yet they remain difficult to study in their native biophysical context. Here we develop a minimally disruptive optical approach to control protein tyrosine phosphatase 1B (PTP1B)-an important regulator of
Caroline E Nunes-Xavier et al.
Diagnostic pathology, 14(1), 134-134 (2019-12-16)
Protein tyrosine phosphatases (PTPs) regulate neuronal differentiation and survival, but their expression patterns and functions in human neuroblastoma (NB) are scarcely known. Here, we have investigated the function and expression of the non-receptor PTPN1 on human NB cell lines and
Liza D Morales et al.
PloS one, 9(5), e97104-e97104 (2014-05-09)
To maintain tissue homeostasis, apoptosis is functionally linked to the cell cycle through the retinoblastoma (Rb)/E2F pathway. When the Rb tumor suppressor protein is functionally inactivated, E2F1 elicits an apoptotic response through both intrinsic (caspase-9 mediated) and extrinsic (caspase-8 mediated)
Samuel Legeay et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 127, 110200-110200 (2020-05-18)
Diabetes notably increases the risk for endothelial dysfunction, a main precursor for microvascular complications. While endoplasmic reticulum stress (ERS) and protein tyrosine phosphatase 1B (PTP1B) have been associated with endothelial dysfunction in resistance vessels, whether these mechanisms also contribute to
Xiaoyan Zhang et al.
Scientific reports, 5, 12987-12987 (2015-08-12)
Renal mesangial cells (RMCs) constitute a population of cells in glomerular mesangium. Inflammatory cytokines produced by RMCs play a vital role in renal inflammation. miRNAs are key regulators of inflammatory cytokine expression. The abnormal expression of renal miRNAs and the

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.