설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AGTGAGCGGAAGAATGTGCTACAGTTGAAACTCCAGCAGCGCCGGACCCGGGAAGAACTGGTGAGCCAAGGGATCATGCCGCCTTTGAAAAGTCCAGCCGCATTTCATGAGCAGAGAAGGAGCTTGGAGCGGGCCAGGACAGAGGACTATCTCAAACGGAAGATTCGTTCCCGGCCGGAGAGATCGGAGCTGGTCAGGATGCACATTTTGGAAGAGACCTCGGCTGAGCCATCCCTCCAGGCCAAGCAGCTGAAGCTGAAGAGAGCCAGACTAGCCGATGACCTCAATGAGAAGATTGCACAGAGGCCTGGCCCCATGGAGCTGGTGGAGAAGAACATCCTTCCTGTTGAGTCCAGCCTGAAGGAAGCCATCATTGTGGGCCAGGTGAACTATCCCAAAGTAGCAGACAGCTCTTCCTTCGATGAGG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... MKL1(57591) , MKL1(57591)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
David Gau et al.
Angiogenesis, 20(4), 663-672 (2017-06-24)
De novo synthesis of cytoskeleton-regulatory proteins triggered by the megakaryoblastic leukemia (MKL)/serum response factor (SRF) transcriptional system in response to pro-angiogenic growth factors lies at the heart of endothelial cell (EC) migration (a critical element of angiogenesis) and neovascularization. This
Xu Shiwen et al.
PloS one, 10(5), e0126015-e0126015 (2015-05-09)
In scleroderma (systemic sclerosis, SSc), persistent activation of myofibroblast leads to severe skin and organ fibrosis resistant to therapy. Increased mechanical stiffness in the involved fibrotic tissues is a hallmark clinical feature and a cause of disabling symptoms. Myocardin Related
Philipp Kircher et al.
Science signaling, 8(402), ra112-ra112 (2015-11-12)
Megakaryoblastic leukemia 1 (MKL1) is a coactivator of serum response factor (SRF) that promotes the expression of genes associated with cell proliferation, motility, adhesion, and differentiation-processes that also involve dynamic cytoskeletal changes in the cell. MKL1 is inactive when bound
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.