설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ATGTTTTCCCGAAACCCTTCAATAGATCCTCACCAGATGTCAAATTTGTTTGTCAGAGCTCCAGCATTGACTTTCTAGCAAGCCAGGGATTTGATTTTAATAAAGTTTTTCGAAATGGAATTCCATATTTAAATCAGGAAGAAGAAAGACAGTTAAGAGAGCAGTATGATGAAAAACGTTCACAGGCGAATGGTGCAGGAGCTCTGTCCTATGTATCTCCTAACACTTCAAAATGTCCTGTCACGATTCCTGAGGATCAAAAGAAGTTTATTGACCAAGTGGTAGAGAAAATAGAGGATTTATTACAAAGTGAAGAAAACAAGAACTTGGATTTAGAGCCATGTACCGGGTTCCAAAGAAAACTAATTTATCAGACTTTGAGCTGGAAGTATCCGAAAGGCATTCATGTTGAGACTTTAGAAACTGAAAAGAAGGAGCGATATATAGTTATCAGCAAAGTAGATGAAGAAGAACGCAAAAGAAGAGAGCAGCAGAAACATGCCAAAGA
Ensembl | 인체 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... PARN(5073) , PARN(5073)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Blanca Nieto et al.
Nature communications, 11(1), 156-156 (2020-01-11)
Technical problems intrinsic to the purification of preribosome intermediates have limited our understanding of ribosome biosynthesis in humans. Addressing this issue is important given the implication of this biological process in human disease. Here we report a preribosome purification and
Penelope Kroustallaki et al.
Cell reports, 28(7), 1690-1702 (2019-08-15)
Telomerase biogenesis is a complex process where several steps remain poorly understood. Single-strand-selective uracil-DNA glycosylase (SMUG1) associates with the DKC1-containing H/ACA ribonucleoprotein complex, which is essential for telomerase biogenesis. Herein, we show that SMUG1 interacts with the telomeric RNA component
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.